Incidental Mutation 'R7311:Vmn2r73'
ID 567584
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Name vomeronasal 2, receptor 73
Synonyms EG620928
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R7311 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 85857547-85875938 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85871984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 259 (S259P)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
AlphaFold D3Z7M3
Predicted Effect possibly damaging
Transcript: ENSMUST00000077478
AA Change: S259P

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: S259P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,750 V118A probably benign Het
2410089E03Rik G T 15: 8,180,915 V291F probably damaging Het
2810403A07Rik T C 3: 88,711,695 S569P probably damaging Het
Accsl C T 2: 93,865,815 G146D possibly damaging Het
Acsm1 A T 7: 119,638,082 H206L probably damaging Het
Acta2 A G 19: 34,241,786 Y339H probably damaging Het
Adcy2 T C 13: 68,630,954 D989G probably damaging Het
Ahnak G A 19: 9,002,143 A264T probably benign Het
Ahnak A G 19: 9,009,827 D2825G possibly damaging Het
AI464131 A G 4: 41,498,577 I351T probably damaging Het
Akt1 G T 12: 112,657,153 T291K probably damaging Het
Arhgap24 A G 5: 102,892,685 D589G probably damaging Het
B4galnt3 G A 6: 120,215,435 Q447* probably null Het
BC024063 C T 10: 82,110,159 R538C possibly damaging Het
Bod1l A G 5: 41,794,333 S2912P possibly damaging Het
Bysl A G 17: 47,601,785 V360A possibly damaging Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Ccdc57 G A 11: 120,873,741 P736L probably benign Het
Cep290 T A 10: 100,537,718 F1287I probably damaging Het
Cntn1 T C 15: 92,232,275 probably null Het
Col6a3 C T 1: 90,822,291 G274R probably damaging Het
Cyb5r4 T C 9: 87,055,782 C285R probably damaging Het
Cyp4f39 G A 17: 32,489,655 C392Y probably damaging Het
Dcun1d3 A T 7: 119,859,511 D100E probably damaging Het
Dhx58 A T 11: 100,698,171 D516E probably benign Het
Dock5 T A 14: 67,828,502 I351F probably benign Het
Elmod2 A C 8: 83,319,412 probably null Het
Endov G A 11: 119,507,251 A281T probably benign Het
Epyc A G 10: 97,649,700 M1V probably null Het
Espnl T A 1: 91,323,568 H128Q probably damaging Het
Fam20a A T 11: 109,674,628 C452* probably null Het
Fam241b A G 10: 62,108,954 V88A probably damaging Het
Fgd3 A T 13: 49,296,690 S28T possibly damaging Het
Fmn1 C A 2: 113,525,680 P920Q unknown Het
Gpr139 G C 7: 119,144,866 D165E probably benign Het
Hoxb1 A G 11: 96,367,101 T286A possibly damaging Het
Ifi204 T A 1: 173,759,568 E174D probably benign Het
Igf2bp2 A G 16: 22,061,882 I555T possibly damaging Het
Ighv1-85 A G 12: 116,000,179 I67T probably damaging Het
Ihh G C 1: 74,951,147 P23R unknown Het
Irx2 T C 13: 72,631,277 S227P probably damaging Het
Itga4 A G 2: 79,256,182 I68V probably benign Het
Jsrp1 T A 10: 80,812,072 T51S probably benign Het
Kifc2 G T 15: 76,662,810 G306V probably damaging Het
L3mbtl2 T A 15: 81,667,387 S85T possibly damaging Het
Lama1 T C 17: 67,767,385 S944P Het
Lama4 T A 10: 39,026,635 C202S probably damaging Het
Lrrc29 A G 8: 105,315,667 probably benign Het
Mkl2 T A 16: 13,405,854 Y866* probably null Het
Morc3 G A 16: 93,849,173 D218N probably damaging Het
N4bp2l1 G A 5: 150,572,924 T179I probably damaging Het
Narf A G 11: 121,249,150 E270G probably benign Het
Nsd2 A G 5: 33,892,036 D1205G probably damaging Het
Olfr235 T C 19: 12,268,704 V158A probably benign Het
Olfr417 T C 1: 174,369,193 V92A probably benign Het
Parl T C 16: 20,287,875 T195A probably benign Het
Phrf1 A G 7: 141,240,933 I158V unknown Het
Phtf1 T C 3: 103,997,664 F543L possibly damaging Het
Plod2 T A 9: 92,584,558 D190E probably damaging Het
Polr1a G T 6: 71,950,879 K871N possibly damaging Het
Ppp2r5a A T 1: 191,357,801 I252K probably damaging Het
Ptgir T A 7: 16,907,048 D88E probably damaging Het
Raly T C 2: 154,857,420 V48A probably damaging Het
Ripor1 T A 8: 105,617,815 L527* probably null Het
Rnf213 T C 11: 119,416,547 S678P Het
Rpf1 T A 3: 146,507,163 Q306L probably benign Het
Rpl14 T C 9: 120,574,105 I122T probably damaging Het
Scn9a C A 2: 66,484,404 A1657S possibly damaging Het
Serpinb10 A G 1: 107,546,747 Y213C probably damaging Het
Slc25a23 A G 17: 57,052,827 L308P probably damaging Het
Smg9 T A 7: 24,420,633 M387K probably benign Het
Socs3 G A 11: 117,967,788 P148L probably benign Het
Susd3 A G 13: 49,248,430 L14P probably benign Het
Syt14 T A 1: 192,980,550 M80L probably benign Het
Tmprss2 T A 16: 97,568,416 Y386F possibly damaging Het
Tmx3 T A 18: 90,540,071 S416T probably benign Het
Treh A G 9: 44,685,948 T555A probably benign Het
Ttc5 T G 14: 50,765,943 Q428P probably damaging Het
Vps4b A T 1: 106,791,704 V38E probably damaging Het
Wdr83 C A 8: 85,076,261 R177L probably benign Het
Zfp780b A G 7: 27,963,163 F656L possibly damaging Het
Zfp995 A T 17: 21,880,660 F198I probably benign Het
Zswim8 A T 14: 20,721,484 Y1495F probably damaging Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
G1Funyon:Vmn2r73 UTSW 7 85858302 missense probably benign 0.00
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R8263:Vmn2r73 UTSW 7 85858411 missense probably benign
R8301:Vmn2r73 UTSW 7 85858302 missense probably benign 0.00
R8341:Vmn2r73 UTSW 7 85857920 missense probably benign 0.01
R8500:Vmn2r73 UTSW 7 85870430 missense probably benign 0.01
R8673:Vmn2r73 UTSW 7 85872694 missense probably benign 0.01
R8719:Vmn2r73 UTSW 7 85871887 missense probably damaging 0.96
R8783:Vmn2r73 UTSW 7 85858460 missense probably damaging 0.96
R8828:Vmn2r73 UTSW 7 85871971 missense probably damaging 0.98
R8860:Vmn2r73 UTSW 7 85872941 splice site probably benign
R9002:Vmn2r73 UTSW 7 85858076 missense probably benign 0.32
R9008:Vmn2r73 UTSW 7 85872696 missense probably damaging 0.96
R9159:Vmn2r73 UTSW 7 85872723 missense possibly damaging 0.90
R9180:Vmn2r73 UTSW 7 85857915 missense probably benign 0.07
R9198:Vmn2r73 UTSW 7 85869779 missense probably benign 0.01
R9329:Vmn2r73 UTSW 7 85869865 missense probably benign
R9448:Vmn2r73 UTSW 7 85872819 missense probably benign 0.00
R9463:Vmn2r73 UTSW 7 85857587 missense
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Z1176:Vmn2r73 UTSW 7 85871968 missense probably damaging 0.99
Z1177:Vmn2r73 UTSW 7 85872272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACAGTTCAGATTGCTGG -3'
(R):5'- CATGGTGTCCTTAGTGGTCC -3'

Sequencing Primer
(F):5'- CCTAGAGGTGTGATCATGT -3'
(R):5'- TCCTTAGTGGTCCATTTCAGATG -3'
Posted On 2019-06-26