Mutagenetix > Incidental Mutations

Incidental Mutation 'R7311:Plod2'

567595

Institutional Source

Beutler Lab

Gene Symbol

Plod2

Ensembl Gene

ENSMUSG00000032374

Gene Name

procollagen lysine, 2-oxoglutarate 5-dioxygenase 2

Synonyms

D530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7311 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92542223-92608428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92584558 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 190 (D190E)

Ref Sequence

ENSEMBL: ENSMUSP00000125373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070522
AA Change: D190E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: D190E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
Blast:P4Hc	453	500	1e-22	BLAST
P4Hc	563	736	6.38e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160359
AA Change: D190E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: D190E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
Blast:P4Hc	453	500	1e-22	BLAST
P4Hc	584	757	6.38e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	A	G	12: 110,668,750	V118A	probably benign	Het
2410089E03Rik	G	T	15: 8,180,915	V291F	probably damaging	Het
2810403A07Rik	T	C	3: 88,711,695	S569P	probably damaging	Het
Accsl	C	T	2: 93,865,815	G146D	possibly damaging	Het
Acsm1	A	T	7: 119,638,082	H206L	probably damaging	Het
Acta2	A	G	19: 34,241,786	Y339H	probably damaging	Het
Adcy2	T	C	13: 68,630,954	D989G	probably damaging	Het
Ahnak	G	A	19: 9,002,143	A264T	probably benign	Het
Ahnak	A	G	19: 9,009,827	D2825G	possibly damaging	Het
AI464131	A	G	4: 41,498,577	I351T	probably damaging	Het
Akt1	G	T	12: 112,657,153	T291K	probably damaging	Het
Arhgap24	A	G	5: 102,892,685	D589G	probably damaging	Het
B4galnt3	G	A	6: 120,215,435	Q447*	probably null	Het
BC024063	C	T	10: 82,110,159	R538C	possibly damaging	Het
Bod1l	A	G	5: 41,794,333	S2912P	possibly damaging	Het
Bysl	A	G	17: 47,601,785	V360A	possibly damaging	Het
C1qb	A	G	4: 136,880,566	V162A	possibly damaging	Het
Ccdc57	G	A	11: 120,873,741	P736L	probably benign	Het
Cep290	T	A	10: 100,537,718	F1287I	probably damaging	Het
Cntn1	T	C	15: 92,232,275		probably null	Het
Col6a3	C	T	1: 90,822,291	G274R	probably damaging	Het
Cyb5r4	T	C	9: 87,055,782	C285R	probably damaging	Het
Cyp4f39	G	A	17: 32,489,655	C392Y	probably damaging	Het
Dcun1d3	A	T	7: 119,859,511	D100E	probably damaging	Het
Dhx58	A	T	11: 100,698,171	D516E	probably benign	Het
Dock5	T	A	14: 67,828,502	I351F	probably benign	Het
Elmod2	A	C	8: 83,319,412		probably null	Het
Endov	G	A	11: 119,507,251	A281T	probably benign	Het
Epyc	A	G	10: 97,649,700	M1V	probably null	Het
Espnl	T	A	1: 91,323,568	H128Q	probably damaging	Het
Fam20a	A	T	11: 109,674,628	C452*	probably null	Het
Fam241b	A	G	10: 62,108,954	V88A	probably damaging	Het
Fgd3	A	T	13: 49,296,690	S28T	possibly damaging	Het
Fmn1	C	A	2: 113,525,680	P920Q	unknown	Het
Gpr139	G	C	7: 119,144,866	D165E	probably benign	Het
Hoxb1	A	G	11: 96,367,101	T286A	possibly damaging	Het
Ifi204	T	A	1: 173,759,568	E174D	probably benign	Het
Igf2bp2	A	G	16: 22,061,882	I555T	possibly damaging	Het
Ighv1-85	A	G	12: 116,000,179	I67T	probably damaging	Het
Ihh	G	C	1: 74,951,147	P23R	unknown	Het
Irx2	T	C	13: 72,631,277	S227P	probably damaging	Het
Itga4	A	G	2: 79,256,182	I68V	probably benign	Het
Jsrp1	T	A	10: 80,812,072	T51S	probably benign	Het
Kifc2	G	T	15: 76,662,810	G306V	probably damaging	Het
L3mbtl2	T	A	15: 81,667,387	S85T	possibly damaging	Het
Lama1	T	C	17: 67,767,385	S944P		Het
Lama4	T	A	10: 39,026,635	C202S	probably damaging	Het
Lrrc29	A	G	8: 105,315,667		probably benign	Het
Mkl2	T	A	16: 13,405,854	Y866*	probably null	Het
Morc3	G	A	16: 93,849,173	D218N	probably damaging	Het
N4bp2l1	G	A	5: 150,572,924	T179I	probably damaging	Het
Narf	A	G	11: 121,249,150	E270G	probably benign	Het
Nsd2	A	G	5: 33,892,036	D1205G	probably damaging	Het
Olfr235	T	C	19: 12,268,704	V158A	probably benign	Het
Olfr417	T	C	1: 174,369,193	V92A	probably benign	Het
Parl	T	C	16: 20,287,875	T195A	probably benign	Het
Phrf1	A	G	7: 141,240,933	I158V	unknown	Het
Phtf1	T	C	3: 103,997,664	F543L	possibly damaging	Het
Polr1a	G	T	6: 71,950,879	K871N	possibly damaging	Het
Ppp2r5a	A	T	1: 191,357,801	I252K	probably damaging	Het
Ptgir	T	A	7: 16,907,048	D88E	probably damaging	Het
Raly	T	C	2: 154,857,420	V48A	probably damaging	Het
Ripor1	T	A	8: 105,617,815	L527*	probably null	Het
Rnf213	T	C	11: 119,416,547	S678P		Het
Rpf1	T	A	3: 146,507,163	Q306L	probably benign	Het
Rpl14	T	C	9: 120,574,105	I122T	probably damaging	Het
Scn9a	C	A	2: 66,484,404	A1657S	possibly damaging	Het
Serpinb10	A	G	1: 107,546,747	Y213C	probably damaging	Het
Slc25a23	A	G	17: 57,052,827	L308P	probably damaging	Het
Smg9	T	A	7: 24,420,633	M387K	probably benign	Het
Socs3	G	A	11: 117,967,788	P148L	probably benign	Het
Susd3	A	G	13: 49,248,430	L14P	probably benign	Het
Syt14	T	A	1: 192,980,550	M80L	probably benign	Het
Tmprss2	T	A	16: 97,568,416	Y386F	possibly damaging	Het
Tmx3	T	A	18: 90,540,071	S416T	probably benign	Het
Treh	A	G	9: 44,685,948	T555A	probably benign	Het
Ttc5	T	G	14: 50,765,943	Q428P	probably damaging	Het
Vmn2r73	A	G	7: 85,871,984	S259P	possibly damaging	Het
Vps4b	A	T	1: 106,791,704	V38E	probably damaging	Het
Wdr83	C	A	8: 85,076,261	R177L	probably benign	Het
Zfp780b	A	G	7: 27,963,163	F656L	possibly damaging	Het
Zfp995	A	T	17: 21,880,660	F198I	probably benign	Het
Zswim8	A	T	14: 20,721,484	Y1495F	probably damaging	Het

Other mutations in Plod2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Plod2	APN	9	92598614	missense	probably damaging	0.99
IGL00945:Plod2	APN	9	92584496	missense	probably benign	0.08
IGL01386:Plod2	APN	9	92606602	missense	probably damaging	0.99
IGL01519:Plod2	APN	9	92595295	missense	probably benign	0.00
IGL01836:Plod2	APN	9	92606498	splice site	probably benign
IGL02490:Plod2	APN	9	92586842	missense	probably benign	0.00
IGL02496:Plod2	APN	9	92607094	missense	probably damaging	1.00
IGL02699:Plod2	APN	9	92607142	missense	probably damaging	1.00
IGL02735:Plod2	APN	9	92595389	splice site	probably benign
IGL03106:Plod2	APN	9	92573567	missense	probably damaging	0.98
R0270:Plod2	UTSW	9	92584521	missense	probably benign	0.10
R0546:Plod2	UTSW	9	92595335	missense	probably damaging	1.00
R0589:Plod2	UTSW	9	92593746	missense	probably benign
R0707:Plod2	UTSW	9	92605427	missense	possibly damaging	0.91
R1491:Plod2	UTSW	9	92606584	missense	probably benign	0.00
R1572:Plod2	UTSW	9	92603067	splice site	probably benign
R1731:Plod2	UTSW	9	92584604	critical splice donor site	probably null
R1895:Plod2	UTSW	9	92607135	missense	probably damaging	1.00
R1917:Plod2	UTSW	9	92581257	missense	probably benign
R1946:Plod2	UTSW	9	92607135	missense	probably damaging	1.00
R3850:Plod2	UTSW	9	92542545	missense	probably benign	0.28
R3973:Plod2	UTSW	9	92598619	nonsense	probably null
R3974:Plod2	UTSW	9	92598619	nonsense	probably null
R4289:Plod2	UTSW	9	92602988	missense	possibly damaging	0.89
R4423:Plod2	UTSW	9	92601989	missense	probably benign	0.00
R4647:Plod2	UTSW	9	92605450	nonsense	probably null
R4754:Plod2	UTSW	9	92606531	nonsense	probably null
R4769:Plod2	UTSW	9	92595272	missense	probably damaging	1.00
R5279:Plod2	UTSW	9	92581323	missense	probably damaging	1.00
R5535:Plod2	UTSW	9	92606569	missense	probably damaging	1.00
R5654:Plod2	UTSW	9	92593823	missense	probably benign
R5764:Plod2	UTSW	9	92603021	missense	probably damaging	0.97
R5885:Plod2	UTSW	9	92606656	critical splice donor site	probably null
R5940:Plod2	UTSW	9	92591397	missense	probably benign	0.39
R6917:Plod2	UTSW	9	92593770	missense	possibly damaging	0.87
R7109:Plod2	UTSW	9	92573597	missense	probably damaging	1.00
R7221:Plod2	UTSW	9	92584527	missense	probably damaging	1.00
Z1088:Plod2	UTSW	9	92603035	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTAGACCTCATGACTTCCCAGC -3'
(R):5'- CACCACTCCATGCTGGTTAC -3'

Sequencing Primer
(F):5'- ATGACTTCCCAGCATTGTCAG -3'
(R):5'- ATTTCTAACTGTGATGGGACCCAC -3'

Posted On

2019-06-26