Incidental Mutation 'R7311:Cep290'
ID567602
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R7311 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100537718 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1287 (F1287I)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219408] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably damaging
Transcript: ENSMUST00000164751
AA Change: F1287I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: F1287I

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219408
Predicted Effect possibly damaging
Transcript: ENSMUST00000219765
AA Change: F1280I

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000220346
AA Change: F1287I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,750 V118A probably benign Het
2410089E03Rik G T 15: 8,180,915 V291F probably damaging Het
2810403A07Rik T C 3: 88,711,695 S569P probably damaging Het
Accsl C T 2: 93,865,815 G146D possibly damaging Het
Acsm1 A T 7: 119,638,082 H206L probably damaging Het
Acta2 A G 19: 34,241,786 Y339H probably damaging Het
Adcy2 T C 13: 68,630,954 D989G probably damaging Het
Ahnak G A 19: 9,002,143 A264T probably benign Het
Ahnak A G 19: 9,009,827 D2825G possibly damaging Het
AI464131 A G 4: 41,498,577 I351T probably damaging Het
Akt1 G T 12: 112,657,153 T291K probably damaging Het
Arhgap24 A G 5: 102,892,685 D589G probably damaging Het
B4galnt3 G A 6: 120,215,435 Q447* probably null Het
BC024063 C T 10: 82,110,159 R538C possibly damaging Het
Bod1l A G 5: 41,794,333 S2912P possibly damaging Het
Bysl A G 17: 47,601,785 V360A possibly damaging Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Ccdc57 G A 11: 120,873,741 P736L probably benign Het
Cntn1 T C 15: 92,232,275 probably null Het
Col6a3 C T 1: 90,822,291 G274R probably damaging Het
Cyb5r4 T C 9: 87,055,782 C285R probably damaging Het
Cyp4f39 G A 17: 32,489,655 C392Y probably damaging Het
Dcun1d3 A T 7: 119,859,511 D100E probably damaging Het
Dhx58 A T 11: 100,698,171 D516E probably benign Het
Dock5 T A 14: 67,828,502 I351F probably benign Het
Elmod2 A C 8: 83,319,412 probably null Het
Endov G A 11: 119,507,251 A281T probably benign Het
Epyc A G 10: 97,649,700 M1V probably null Het
Espnl T A 1: 91,323,568 H128Q probably damaging Het
Fam20a A T 11: 109,674,628 C452* probably null Het
Fam241b A G 10: 62,108,954 V88A probably damaging Het
Fgd3 A T 13: 49,296,690 S28T possibly damaging Het
Fmn1 C A 2: 113,525,680 P920Q unknown Het
Gpr139 G C 7: 119,144,866 D165E probably benign Het
Hoxb1 A G 11: 96,367,101 T286A possibly damaging Het
Ifi204 T A 1: 173,759,568 E174D probably benign Het
Igf2bp2 A G 16: 22,061,882 I555T possibly damaging Het
Ighv1-85 A G 12: 116,000,179 I67T probably damaging Het
Ihh G C 1: 74,951,147 P23R unknown Het
Irx2 T C 13: 72,631,277 S227P probably damaging Het
Itga4 A G 2: 79,256,182 I68V probably benign Het
Jsrp1 T A 10: 80,812,072 T51S probably benign Het
Kifc2 G T 15: 76,662,810 G306V probably damaging Het
L3mbtl2 T A 15: 81,667,387 S85T possibly damaging Het
Lama1 T C 17: 67,767,385 S944P Het
Lama4 T A 10: 39,026,635 C202S probably damaging Het
Lrrc29 A G 8: 105,315,667 probably benign Het
Mkl2 T A 16: 13,405,854 Y866* probably null Het
Morc3 G A 16: 93,849,173 D218N probably damaging Het
N4bp2l1 G A 5: 150,572,924 T179I probably damaging Het
Narf A G 11: 121,249,150 E270G probably benign Het
Nsd2 A G 5: 33,892,036 D1205G probably damaging Het
Olfr235 T C 19: 12,268,704 V158A probably benign Het
Olfr417 T C 1: 174,369,193 V92A probably benign Het
Parl T C 16: 20,287,875 T195A probably benign Het
Phrf1 A G 7: 141,240,933 I158V unknown Het
Phtf1 T C 3: 103,997,664 F543L possibly damaging Het
Plod2 T A 9: 92,584,558 D190E probably damaging Het
Polr1a G T 6: 71,950,879 K871N possibly damaging Het
Ppp2r5a A T 1: 191,357,801 I252K probably damaging Het
Ptgir T A 7: 16,907,048 D88E probably damaging Het
Raly T C 2: 154,857,420 V48A probably damaging Het
Ripor1 T A 8: 105,617,815 L527* probably null Het
Rnf213 T C 11: 119,416,547 S678P Het
Rpf1 T A 3: 146,507,163 Q306L probably benign Het
Rpl14 T C 9: 120,574,105 I122T probably damaging Het
Scn9a C A 2: 66,484,404 A1657S possibly damaging Het
Serpinb10 A G 1: 107,546,747 Y213C probably damaging Het
Slc25a23 A G 17: 57,052,827 L308P probably damaging Het
Smg9 T A 7: 24,420,633 M387K probably benign Het
Socs3 G A 11: 117,967,788 P148L probably benign Het
Susd3 A G 13: 49,248,430 L14P probably benign Het
Syt14 T A 1: 192,980,550 M80L probably benign Het
Tmprss2 T A 16: 97,568,416 Y386F possibly damaging Het
Tmx3 T A 18: 90,540,071 S416T probably benign Het
Treh A G 9: 44,685,948 T555A probably benign Het
Ttc5 T G 14: 50,765,943 Q428P probably damaging Het
Vmn2r73 A G 7: 85,871,984 S259P possibly damaging Het
Vps4b A T 1: 106,791,704 V38E probably damaging Het
Wdr83 C A 8: 85,076,261 R177L probably benign Het
Zfp780b A G 7: 27,963,163 F656L possibly damaging Het
Zfp995 A T 17: 21,880,660 F198I probably benign Het
Zswim8 A T 14: 20,721,484 Y1495F probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTGCCCTCGGTAAGTTAGAG -3'
(R):5'- CAGATCAAGTTTTACCTTCTGGGC -3'

Sequencing Primer
(F):5'- CCCTCGGTAAGTTAGAGTCAGTTAC -3'
(R):5'- GCTCCCCTGGCATCCTTTAAAG -3'
Posted On2019-06-26