Incidental Mutation 'R7311:Tmprss2'
ID567629
Institutional Source Beutler Lab
Gene Symbol Tmprss2
Ensembl Gene ENSMUSG00000000385
Gene Nametransmembrane protease, serine 2
Synonymsepitheliasin, D16Ertd61e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7311 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location97564682-97611195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97568416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 386 (Y386F)
Ref Sequence ENSEMBL: ENSMUSP00000000395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000395]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000395
AA Change: Y386F

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000395
Gene: ENSMUSG00000000385
AA Change: Y386F

DomainStartEndE-ValueType
transmembrane domain 86 108 N/A INTRINSIC
LDLa 111 149 1e-9 SMART
SR 148 241 8.55e-10 SMART
Tryp_SPc 253 482 4.58e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik A G 12: 110,668,750 V118A probably benign Het
2410089E03Rik G T 15: 8,180,915 V291F probably damaging Het
2810403A07Rik T C 3: 88,711,695 S569P probably damaging Het
Accsl C T 2: 93,865,815 G146D possibly damaging Het
Acsm1 A T 7: 119,638,082 H206L probably damaging Het
Acta2 A G 19: 34,241,786 Y339H probably damaging Het
Adcy2 T C 13: 68,630,954 D989G probably damaging Het
Ahnak G A 19: 9,002,143 A264T probably benign Het
Ahnak A G 19: 9,009,827 D2825G possibly damaging Het
AI464131 A G 4: 41,498,577 I351T probably damaging Het
Akt1 G T 12: 112,657,153 T291K probably damaging Het
Arhgap24 A G 5: 102,892,685 D589G probably damaging Het
B4galnt3 G A 6: 120,215,435 Q447* probably null Het
BC024063 C T 10: 82,110,159 R538C possibly damaging Het
Bod1l A G 5: 41,794,333 S2912P possibly damaging Het
Bysl A G 17: 47,601,785 V360A possibly damaging Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Ccdc57 G A 11: 120,873,741 P736L probably benign Het
Cep290 T A 10: 100,537,718 F1287I probably damaging Het
Cntn1 T C 15: 92,232,275 probably null Het
Col6a3 C T 1: 90,822,291 G274R probably damaging Het
Cyb5r4 T C 9: 87,055,782 C285R probably damaging Het
Cyp4f39 G A 17: 32,489,655 C392Y probably damaging Het
Dcun1d3 A T 7: 119,859,511 D100E probably damaging Het
Dhx58 A T 11: 100,698,171 D516E probably benign Het
Dock5 T A 14: 67,828,502 I351F probably benign Het
Elmod2 A C 8: 83,319,412 probably null Het
Endov G A 11: 119,507,251 A281T probably benign Het
Epyc A G 10: 97,649,700 M1V probably null Het
Espnl T A 1: 91,323,568 H128Q probably damaging Het
Fam20a A T 11: 109,674,628 C452* probably null Het
Fam241b A G 10: 62,108,954 V88A probably damaging Het
Fgd3 A T 13: 49,296,690 S28T possibly damaging Het
Fmn1 C A 2: 113,525,680 P920Q unknown Het
Gpr139 G C 7: 119,144,866 D165E probably benign Het
Hoxb1 A G 11: 96,367,101 T286A possibly damaging Het
Ifi204 T A 1: 173,759,568 E174D probably benign Het
Igf2bp2 A G 16: 22,061,882 I555T possibly damaging Het
Ighv1-85 A G 12: 116,000,179 I67T probably damaging Het
Ihh G C 1: 74,951,147 P23R unknown Het
Irx2 T C 13: 72,631,277 S227P probably damaging Het
Itga4 A G 2: 79,256,182 I68V probably benign Het
Jsrp1 T A 10: 80,812,072 T51S probably benign Het
Kifc2 G T 15: 76,662,810 G306V probably damaging Het
L3mbtl2 T A 15: 81,667,387 S85T possibly damaging Het
Lama1 T C 17: 67,767,385 S944P Het
Lama4 T A 10: 39,026,635 C202S probably damaging Het
Lrrc29 A G 8: 105,315,667 probably benign Het
Mkl2 T A 16: 13,405,854 Y866* probably null Het
Morc3 G A 16: 93,849,173 D218N probably damaging Het
N4bp2l1 G A 5: 150,572,924 T179I probably damaging Het
Narf A G 11: 121,249,150 E270G probably benign Het
Nsd2 A G 5: 33,892,036 D1205G probably damaging Het
Olfr235 T C 19: 12,268,704 V158A probably benign Het
Olfr417 T C 1: 174,369,193 V92A probably benign Het
Parl T C 16: 20,287,875 T195A probably benign Het
Phrf1 A G 7: 141,240,933 I158V unknown Het
Phtf1 T C 3: 103,997,664 F543L possibly damaging Het
Plod2 T A 9: 92,584,558 D190E probably damaging Het
Polr1a G T 6: 71,950,879 K871N possibly damaging Het
Ppp2r5a A T 1: 191,357,801 I252K probably damaging Het
Ptgir T A 7: 16,907,048 D88E probably damaging Het
Raly T C 2: 154,857,420 V48A probably damaging Het
Ripor1 T A 8: 105,617,815 L527* probably null Het
Rnf213 T C 11: 119,416,547 S678P Het
Rpf1 T A 3: 146,507,163 Q306L probably benign Het
Rpl14 T C 9: 120,574,105 I122T probably damaging Het
Scn9a C A 2: 66,484,404 A1657S possibly damaging Het
Serpinb10 A G 1: 107,546,747 Y213C probably damaging Het
Slc25a23 A G 17: 57,052,827 L308P probably damaging Het
Smg9 T A 7: 24,420,633 M387K probably benign Het
Socs3 G A 11: 117,967,788 P148L probably benign Het
Susd3 A G 13: 49,248,430 L14P probably benign Het
Syt14 T A 1: 192,980,550 M80L probably benign Het
Tmx3 T A 18: 90,540,071 S416T probably benign Het
Treh A G 9: 44,685,948 T555A probably benign Het
Ttc5 T G 14: 50,765,943 Q428P probably damaging Het
Vmn2r73 A G 7: 85,871,984 S259P possibly damaging Het
Vps4b A T 1: 106,791,704 V38E probably damaging Het
Wdr83 C A 8: 85,076,261 R177L probably benign Het
Zfp780b A G 7: 27,963,163 F656L possibly damaging Het
Zfp995 A T 17: 21,880,660 F198I probably benign Het
Zswim8 A T 14: 20,721,484 Y1495F probably damaging Het
Other mutations in Tmprss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Tmprss2 APN 16 97578595 nonsense probably null
IGL02130:Tmprss2 APN 16 97590889 missense probably damaging 1.00
IGL02149:Tmprss2 APN 16 97599279 utr 5 prime probably benign
IGL03080:Tmprss2 APN 16 97596844 missense probably damaging 0.98
PIT4480001:Tmprss2 UTSW 16 97599260 missense possibly damaging 0.77
R0395:Tmprss2 UTSW 16 97567045 missense probably damaging 1.00
R0485:Tmprss2 UTSW 16 97571994 unclassified probably benign
R1055:Tmprss2 UTSW 16 97576262 missense probably damaging 1.00
R1080:Tmprss2 UTSW 16 97591498 missense probably benign
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1930:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1931:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1955:Tmprss2 UTSW 16 97567177 critical splice acceptor site probably null
R2443:Tmprss2 UTSW 16 97568503 missense possibly damaging 0.65
R3825:Tmprss2 UTSW 16 97596821 missense probably damaging 1.00
R4508:Tmprss2 UTSW 16 97570427 missense probably damaging 1.00
R5212:Tmprss2 UTSW 16 97576292 missense probably benign 0.00
R5571:Tmprss2 UTSW 16 97590871 missense probably null 1.00
R5715:Tmprss2 UTSW 16 97568983 missense possibly damaging 0.65
R6816:Tmprss2 UTSW 16 97568467 missense possibly damaging 0.94
R6921:Tmprss2 UTSW 16 97568437 missense probably damaging 0.98
R7230:Tmprss2 UTSW 16 97578597 missense probably benign 0.02
R7788:Tmprss2 UTSW 16 97576229 nonsense probably null
R8052:Tmprss2 UTSW 16 97568416 missense probably damaging 1.00
Z1176:Tmprss2 UTSW 16 97567057 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTCTTCCTATGTGCTAGGTAG -3'
(R):5'- AAGCTGCAGACACCTTTGGC -3'

Sequencing Primer
(F):5'- CCTATGTGCTAGGTAGGGTTAATTTG -3'
(R):5'- TTAATGGTACGTGAGACTCAGCCC -3'
Posted On2019-06-26