Incidental Mutation 'R7312:Dusp27'
ID567642
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7312 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 166127107 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 25 (V25I)
Ref Sequence ENSEMBL: ENSMUSP00000083155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060833] [ENSMUST00000085992] [ENSMUST00000166159] [ENSMUST00000166860] [ENSMUST00000192369]
Predicted Effect probably benign
Transcript: ENSMUST00000060833
SMART Domains Protein: ENSMUSP00000060147
Gene: ENSMUSG00000000544

DomainStartEndE-ValueType
IGv 38 119 1.26e-9 SMART
IGc2 153 218 3.03e-12 SMART
transmembrane domain 235 257 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: V25I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: V25I

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166159
Predicted Effect probably benign
Transcript: ENSMUST00000166860
SMART Domains Protein: ENSMUSP00000125903
Gene: ENSMUSG00000000544

DomainStartEndE-ValueType
IGv 38 119 1.26e-9 SMART
IGc2 153 218 3.03e-12 SMART
transmembrane domain 235 257 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: V25I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: V25I

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dmgdh A G 13: 93,708,846 probably null Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Lrrfip2 T A 9: 111,177,457 probably null Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp28 G T 7: 6,383,594 probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R0542:Dusp27 UTSW 1 166101284 missense possibly damaging 0.90
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R3727:Dusp27 UTSW 1 166099506 missense probably damaging 1.00
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4955:Dusp27 UTSW 1 166108092 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6222:Dusp27 UTSW 1 166098645 missense probably benign 0.26
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R6958:Dusp27 UTSW 1 166107996 missense probably damaging 1.00
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7569:Dusp27 UTSW 1 166108035 missense probably damaging 1.00
R7920:Dusp27 UTSW 1 166099896 missense possibly damaging 0.72
R7954:Dusp27 UTSW 1 166099280 missense probably benign 0.05
R7972:Dusp27 UTSW 1 166099139 missense probably damaging 1.00
R8186:Dusp27 UTSW 1 166100079 missense probably damaging 1.00
R8354:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8454:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8535:Dusp27 UTSW 1 166101161 missense probably benign 0.01
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCTCTGGTCTTTCCC -3'
(R):5'- CCATTCTCAGTCCACCAAGG -3'

Sequencing Primer
(F):5'- CTGTGTGCTTGTCACCCC -3'
(R):5'- GTGACATTGGTGACACGTCC -3'
Posted On2019-06-26