Incidental Mutation 'R7312:Tln1'
ID 567653
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission 045410-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7312 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43545922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 898 (R898C)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: R898C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: R898C

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 89,969,021 (GRCm39) S215P probably benign Het
Ano2 C T 6: 126,016,460 (GRCm39) Q998* probably null Het
Atg9a A T 1: 75,164,736 (GRCm39) V76E probably damaging Het
Cacna1c T C 6: 119,034,172 (GRCm39) I118M Het
Cacna1g T A 11: 94,323,383 (GRCm39) I1274F probably damaging Het
Cd300lg C T 11: 101,937,767 (GRCm39) A199V probably benign Het
Cfap61 C T 2: 145,887,390 (GRCm39) R612* probably null Het
Cpeb4 A T 11: 31,881,417 (GRCm39) Y692F probably damaging Het
Dcun1d1 A G 3: 35,951,940 (GRCm39) probably null Het
Dennd2d T A 3: 106,398,579 (GRCm39) M188K probably benign Het
Dmgdh A G 13: 93,845,354 (GRCm39) probably null Het
Efl1 T A 7: 82,330,652 (GRCm39) M275K probably benign Het
Erp29 G T 5: 121,583,392 (GRCm39) A178D probably benign Het
Fbn1 T C 2: 125,308,594 (GRCm39) N156S possibly damaging Het
Frrs1 C T 3: 116,675,426 (GRCm39) T118I probably damaging Het
Frrs1l A G 4: 56,968,230 (GRCm39) W181R probably benign Het
Gprc5b C A 7: 118,583,482 (GRCm39) W129L probably damaging Het
Hoxc9 A G 15: 102,890,593 (GRCm39) H170R probably benign Het
Il12rb2 C T 6: 67,333,617 (GRCm39) D221N probably benign Het
Lmo1 T C 7: 108,742,819 (GRCm39) N28S probably benign Het
Lrrfip2 T A 9: 111,006,525 (GRCm39) probably null Het
Macf1 A T 4: 123,400,130 (GRCm39) F722I probably damaging Het
Mical1 T C 10: 41,355,772 (GRCm39) probably null Het
Mtcl3 A G 10: 29,073,240 (GRCm39) Y844C probably damaging Het
Mtmr11 C T 3: 96,071,855 (GRCm39) T223M possibly damaging Het
Mup21 A G 4: 62,068,468 (GRCm39) V66A probably benign Het
Nav2 C A 7: 49,111,672 (GRCm39) A726D possibly damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nudt21 A T 8: 94,746,227 (GRCm39) V157D probably benign Het
Numa1 T C 7: 101,639,806 (GRCm39) I52T possibly damaging Het
Obscn T C 11: 58,946,442 (GRCm39) D4421G probably benign Het
Oog3 T C 4: 143,886,801 (GRCm39) I106M probably benign Het
Or10g9 A T 9: 39,912,106 (GRCm39) V139E probably benign Het
Or2g25 T C 17: 37,970,403 (GRCm39) T274A possibly damaging Het
Or2z9 T C 8: 72,853,793 (GRCm39) L63P probably damaging Het
Or51f1 T A 7: 102,505,706 (GRCm39) Y261F probably damaging Het
Or5w20 T G 2: 87,726,755 (GRCm39) C71G possibly damaging Het
Orai2 T A 5: 136,179,437 (GRCm39) I199F probably damaging Het
P2rx5 C A 11: 73,055,692 (GRCm39) L50M probably damaging Het
Pdia2 T C 17: 26,416,634 (GRCm39) E215G possibly damaging Het
Pds5a A T 5: 65,823,570 (GRCm39) S74T possibly damaging Het
Phlpp2 A G 8: 110,666,785 (GRCm39) S1105G probably damaging Het
Pi4kb T A 3: 94,891,888 (GRCm39) D189E probably benign Het
Pigw G A 11: 84,768,585 (GRCm39) T248M probably damaging Het
Pnlip T A 19: 58,670,134 (GRCm39) V458D probably damaging Het
Ppm1l G A 3: 69,225,044 (GRCm39) V49I probably benign Het
Prl3b1 T A 13: 27,426,473 (GRCm39) M1K probably null Het
Rad1 T A 15: 10,493,367 (GRCm39) C265S probably benign Het
Rnaset2b C T 17: 7,265,427 (GRCm39) S237F probably benign Het
Rtl1 C T 12: 109,561,672 (GRCm39) A56T unknown Het
S1pr2 T C 9: 20,879,238 (GRCm39) I197V probably benign Het
Smyd4 A G 11: 75,281,082 (GRCm39) Q185R probably benign Het
Sox5 T A 6: 144,100,759 (GRCm39) T77S probably benign Het
Sox7 A G 14: 64,185,291 (GRCm39) Y109C probably damaging Het
Styxl2 C T 1: 165,954,676 (GRCm39) V25I probably damaging Het
Tmprss11b T A 5: 86,812,173 (GRCm39) E158V probably damaging Het
Tnpo3 C A 6: 29,562,875 (GRCm39) R614L possibly damaging Het
Vmn2r100 T A 17: 19,742,296 (GRCm39) D223E probably benign Het
Zc3h12d A T 10: 7,743,345 (GRCm39) M372L probably benign Het
Zfp28 G T 7: 6,386,593 (GRCm39) probably benign Het
Zfp963 A T 8: 70,195,759 (GRCm39) H231Q probably damaging Het
Zscan4b A G 7: 10,634,867 (GRCm39) S459P probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm39) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm39) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm39) missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43,542,893 (GRCm39) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm39) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCAGCAATGGTCTGTGTTGC -3'
(R):5'- AGCCTCAGTGAAGGTAATTCG -3'

Sequencing Primer
(F):5'- CAGAGGCTGCAGCTTGCTTG -3'
(R):5'- CCTCAGTGAAGGTAATTCGAAATTAG -3'
Posted On 2019-06-26