Incidental Mutation 'R7312:Zscan4b'
ID567667
Institutional Source Beutler Lab
Gene Symbol Zscan4b
Ensembl Gene ENSMUSG00000095339
Gene Namezinc finger and SCAN domain containing 4B
SynonymsEG665780
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7312 (G1)
Quality Score145.008
Status Not validated
Chromosome7
Chromosomal Location10900740-10905050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10900940 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 459 (S459P)
Ref Sequence ENSEMBL: ENSMUSP00000127301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168158] [ENSMUST00000210847]
Predicted Effect probably benign
Transcript: ENSMUST00000168158
AA Change: S459P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127301
Gene: ENSMUSG00000095339
AA Change: S459P

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.8e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210847
AA Change: S459P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dmgdh A G 13: 93,708,846 probably null Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Lrrfip2 T A 9: 111,177,457 probably null Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp28 G T 7: 6,383,594 probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Other mutations in Zscan4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4696001:Zscan4b UTSW 7 10902022 missense possibly damaging 0.77
R0628:Zscan4b UTSW 7 10901463 missense probably damaging 0.99
R2289:Zscan4b UTSW 7 10901862 critical splice donor site probably null
R3713:Zscan4b UTSW 7 10901891 missense probably benign 0.01
R6129:Zscan4b UTSW 7 10901888 missense probably benign 0.01
R6393:Zscan4b UTSW 7 10900901 missense possibly damaging 0.76
R7057:Zscan4b UTSW 7 10901709 nonsense probably null
R7383:Zscan4b UTSW 7 10904033 missense possibly damaging 0.92
R7412:Zscan4b UTSW 7 10900864 missense probably damaging 1.00
R7412:Zscan4b UTSW 7 10901893 missense probably benign 0.03
R7449:Zscan4b UTSW 7 10904058 missense possibly damaging 0.95
Z1177:Zscan4b UTSW 7 10901737 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTACCAGTCTCTGCTGAGGATG -3'
(R):5'- CAAAAGAGATTCCATAGAGATGCC -3'

Sequencing Primer
(F):5'- CAGTCTCTGCTGAGGATGTTAGATAC -3'
(R):5'- CATAGAGATGCCAAACTATACAAGTG -3'
Posted On2019-06-26