Incidental Mutation 'R7312:Efl1'
ID567669
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R7312 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82681444 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 275 (M275K)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: M275K

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: M275K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: M275K

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: M275K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dmgdh A G 13: 93,708,846 probably null Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Lrrfip2 T A 9: 111,177,457 probably null Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp28 G T 7: 6,383,594 probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTCTGAATGGTATATGGCAAAG -3'
(R):5'- TTGCTCACTGTCTTTACAAAGCG -3'

Sequencing Primer
(F):5'- GAAACAGTGAAGGGTTAGCTGTATTC -3'
(R):5'- CTCACTGTCTTTACAAAGCGAAAGTC -3'
Posted On2019-06-26