Incidental Mutation 'R7312:Olfr566'
ID567671
Institutional Source Beutler Lab
Gene Symbol Olfr566
Ensembl Gene ENSMUSG00000060888
Gene Nameolfactory receptor 566
SynonymsMOR14-7P, GA_x6K02T2PBJ9-5560696-5559746
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7312 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102855337-102858765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102856499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 261 (Y261F)
Ref Sequence ENSEMBL: ENSMUSP00000148058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071393] [ENSMUST00000209952] [ENSMUST00000213481]
Predicted Effect probably damaging
Transcript: ENSMUST00000071393
AA Change: Y258F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071344
Gene: ENSMUSG00000060888
AA Change: Y258F

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 1e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 313 3.5e-6 PFAM
Pfam:7tm_1 47 298 9.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209952
AA Change: Y261F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213481
AA Change: Y261F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2660 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dmgdh A G 13: 93,708,846 probably null Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Lrrfip2 T A 9: 111,177,457 probably null Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp28 G T 7: 6,383,594 probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in Olfr566
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr566 APN 7 102856824 missense probably benign
IGL03336:Olfr566 APN 7 102856616 missense probably benign 0.38
PIT4382001:Olfr566 UTSW 7 102856602 missense probably damaging 1.00
R1337:Olfr566 UTSW 7 102856871 missense probably benign 0.03
R1791:Olfr566 UTSW 7 102856362 nonsense probably null
R3953:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3954:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3955:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3957:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R4734:Olfr566 UTSW 7 102856979 missense probably damaging 0.99
R5182:Olfr566 UTSW 7 102856969 missense probably benign 0.07
R5394:Olfr566 UTSW 7 102856479 missense probably damaging 1.00
R5559:Olfr566 UTSW 7 102857207 missense possibly damaging 0.94
R6023:Olfr566 UTSW 7 102856962 missense possibly damaging 0.95
R6310:Olfr566 UTSW 7 102857205 missense probably benign 0.01
R7493:Olfr566 UTSW 7 102857071 nonsense probably null
R8409:Olfr566 UTSW 7 102857270 missense probably benign 0.01
R8476:Olfr566 UTSW 7 102856945 missense probably benign 0.22
R8747:Olfr566 UTSW 7 102856932 missense probably benign 0.05
R8946:Olfr566 UTSW 7 102856518 nonsense probably null
Z1177:Olfr566 UTSW 7 102856374 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGAACATGAAAATCACACCAGG -3'
(R):5'- TGTTCAGACACTCGAGCCAATAG -3'

Sequencing Primer
(F):5'- CTGTGTTCATTTTGCAAAGAGC -3'
(R):5'- CCAATAGCATCTGTGGACTAGTTG -3'
Posted On2019-06-26