Incidental Mutation 'R7312:P2rx5'
ID567685
Institutional Source Beutler Lab
Gene Symbol P2rx5
Ensembl Gene ENSMUSG00000005950
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 5
SynonymsP2X5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7312 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73160421-73172685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73164866 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 50 (L50M)
Ref Sequence ENSEMBL: ENSMUSP00000006104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006104] [ENSMUST00000135202] [ENSMUST00000136894]
Predicted Effect probably damaging
Transcript: ENSMUST00000006104
AA Change: L50M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006104
Gene: ENSMUSG00000005950
AA Change: L50M

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 382 2.1e-161 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135202
AA Change: L50M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118448
Gene: ENSMUSG00000005950
AA Change: L50M

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 307 1.8e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136894
AA Change: L50M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121834
Gene: ENSMUSG00000005950
AA Change: L50M

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 331 2.9e-144 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit decreased peripheral blood CD8+ lymphocytes and elevated NK cells. Impaired learning/memory during trace aversive conditioning and increased exploratory behavior during open field testing is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dmgdh A G 13: 93,708,846 probably null Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Lrrfip2 T A 9: 111,177,457 probably null Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp28 G T 7: 6,383,594 probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in P2rx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:P2rx5 APN 11 73167492 critical splice acceptor site probably null
IGL01860:P2rx5 APN 11 73165559 missense probably damaging 0.98
IGL02019:P2rx5 APN 11 73167977 splice site probably benign
IGL03079:P2rx5 APN 11 73164888 missense possibly damaging 0.92
IGL03088:P2rx5 APN 11 73165620 splice site probably benign
R0014:P2rx5 UTSW 11 73167062 splice site probably benign
R0845:P2rx5 UTSW 11 73165574 missense probably damaging 1.00
R1384:P2rx5 UTSW 11 73167890 missense probably damaging 1.00
R3415:P2rx5 UTSW 11 73160660 missense possibly damaging 0.94
R4155:P2rx5 UTSW 11 73171829 missense probably damaging 0.96
R4641:P2rx5 UTSW 11 73167564 missense possibly damaging 0.58
R4750:P2rx5 UTSW 11 73164877 missense probably damaging 1.00
R4854:P2rx5 UTSW 11 73171779 missense probably benign 0.23
R5186:P2rx5 UTSW 11 73171790 missense possibly damaging 0.68
R7003:P2rx5 UTSW 11 73167974 critical splice donor site probably null
R7141:P2rx5 UTSW 11 73160648 missense probably damaging 1.00
X0004:P2rx5 UTSW 11 73166989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCTACTTTCCAGCTTTAGCAC -3'
(R):5'- TGATGCAGTTCTCTGGGCAC -3'

Sequencing Primer
(F):5'- GCTTTAGCACACTGACTGCAG -3'
(R):5'- GGGCACTTCCTATGTGACC -3'
Posted On2019-06-26