Incidental Mutation 'R7312:Vmn2r100'
ID567696
Institutional Source Beutler Lab
Gene Symbol Vmn2r100
Ensembl Gene ENSMUSG00000091859
Gene Namevomeronasal 2, receptor 100
SynonymsEG627537
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7312 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location19504732-19535231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19522034 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 223 (D223E)
Ref Sequence ENSEMBL: ENSMUSP00000128350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166081] [ENSMUST00000231465]
Predicted Effect probably benign
Transcript: ENSMUST00000166081
AA Change: D223E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128350
Gene: ENSMUSG00000091859
AA Change: D223E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 456 7.4e-41 PFAM
Pfam:NCD3G 510 563 1.9e-21 PFAM
Pfam:7tm_3 594 831 2.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231465
AA Change: D223E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,061,714 S215P probably benign Het
Ano2 C T 6: 126,039,497 Q998* probably null Het
Atg9a A T 1: 75,188,092 V76E probably damaging Het
Cacna1c T C 6: 119,057,211 I118M Het
Cacna1g T A 11: 94,432,557 I1274F probably damaging Het
Cd300lg C T 11: 102,046,941 A199V probably benign Het
Cfap61 C T 2: 146,045,470 R612* probably null Het
Cpeb4 A T 11: 31,931,417 Y692F probably damaging Het
Dcun1d1 A G 3: 35,897,791 probably null Het
Dennd2d T A 3: 106,491,263 M188K probably benign Het
Dmgdh A G 13: 93,708,846 probably null Het
Dusp27 C T 1: 166,127,107 V25I probably damaging Het
Efl1 T A 7: 82,681,444 M275K probably benign Het
Erp29 G T 5: 121,445,329 A178D probably benign Het
Fbn1 T C 2: 125,466,674 N156S possibly damaging Het
Frrs1 C T 3: 116,881,777 T118I probably damaging Het
Frrs1l A G 4: 56,968,230 W181R probably benign Het
Gprc5b C A 7: 118,984,259 W129L probably damaging Het
Hoxc9 A G 15: 102,982,161 H170R probably benign Het
Il12rb2 C T 6: 67,356,633 D221N probably benign Het
Lmo1 T C 7: 109,143,612 N28S probably benign Het
Lrrfip2 T A 9: 111,177,457 probably null Het
Macf1 A T 4: 123,506,337 F722I probably damaging Het
Mical1 T C 10: 41,479,776 probably null Het
Mtmr11 C T 3: 96,164,538 T223M possibly damaging Het
Mup21 A G 4: 62,150,231 V66A probably benign Het
Nav2 C A 7: 49,461,924 A726D possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nudt21 A T 8: 94,019,599 V157D probably benign Het
Numa1 T C 7: 101,990,599 I52T possibly damaging Het
Obscn T C 11: 59,055,616 D4421G probably benign Het
Olfr1153 T G 2: 87,896,411 C71G possibly damaging Het
Olfr117 T C 17: 37,659,512 T274A possibly damaging Het
Olfr373 T C 8: 72,099,949 L63P probably damaging Het
Olfr566 T A 7: 102,856,499 Y261F probably damaging Het
Olfr979 A T 9: 40,000,810 V139E probably benign Het
Oog3 T C 4: 144,160,231 I106M probably benign Het
Orai2 T A 5: 136,150,583 I199F probably damaging Het
P2rx5 C A 11: 73,164,866 L50M probably damaging Het
Pdia2 T C 17: 26,197,660 E215G possibly damaging Het
Pds5a A T 5: 65,666,227 S74T possibly damaging Het
Phlpp2 A G 8: 109,940,153 S1105G probably damaging Het
Pi4kb T A 3: 94,984,577 D189E probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pnlip T A 19: 58,681,702 V458D probably damaging Het
Ppm1l G A 3: 69,317,711 V49I probably benign Het
Prl3b1 T A 13: 27,242,490 M1K probably null Het
Rad1 T A 15: 10,493,281 C265S probably benign Het
Rnaset2b C T 17: 6,998,028 S237F probably benign Het
Rtl1 C T 12: 109,595,238 A56T unknown Het
S1pr2 T C 9: 20,967,942 I197V probably benign Het
Smyd4 A G 11: 75,390,256 Q185R probably benign Het
Soga3 A G 10: 29,197,244 Y844C probably damaging Het
Sox5 T A 6: 144,155,033 T77S probably benign Het
Sox7 A G 14: 63,947,842 Y109C probably damaging Het
Tln1 G A 4: 43,545,922 R898C probably damaging Het
Tmprss11b T A 5: 86,664,314 E158V probably damaging Het
Tnpo3 C A 6: 29,562,876 R614L possibly damaging Het
Zc3h12d A T 10: 7,867,581 M372L probably benign Het
Zfp28 G T 7: 6,383,594 probably benign Het
Zfp963 A T 8: 69,743,109 H231Q probably damaging Het
Zscan4b A G 7: 10,900,940 S459P probably benign Het
Other mutations in Vmn2r100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Vmn2r100 APN 17 19526000 missense probably damaging 1.00
IGL00912:Vmn2r100 APN 17 19531392 missense possibly damaging 0.95
IGL01107:Vmn2r100 APN 17 19521356 missense probably damaging 1.00
IGL01517:Vmn2r100 APN 17 19521963 missense probably benign 0.37
IGL01594:Vmn2r100 APN 17 19531233 missense possibly damaging 0.52
IGL01657:Vmn2r100 APN 17 19525916 missense possibly damaging 0.89
IGL01822:Vmn2r100 APN 17 19504838 missense probably null 0.00
IGL02020:Vmn2r100 APN 17 19504938 missense possibly damaging 0.78
IGL02060:Vmn2r100 APN 17 19521254 missense possibly damaging 0.79
IGL02126:Vmn2r100 APN 17 19521242 splice site probably benign
IGL02142:Vmn2r100 APN 17 19522321 missense probably damaging 1.00
IGL02308:Vmn2r100 APN 17 19521335 missense possibly damaging 0.90
IGL02407:Vmn2r100 APN 17 19521508 missense probably damaging 0.98
IGL02469:Vmn2r100 APN 17 19531285 nonsense probably null
IGL03088:Vmn2r100 APN 17 19522039 missense probably benign 0.27
IGL03181:Vmn2r100 APN 17 19531945 missense probably damaging 1.00
IGL03405:Vmn2r100 APN 17 19531924 missense probably damaging 1.00
H8562:Vmn2r100 UTSW 17 19521490 missense possibly damaging 0.87
R0012:Vmn2r100 UTSW 17 19504874 missense probably benign
R0012:Vmn2r100 UTSW 17 19526034 missense probably damaging 0.99
R0044:Vmn2r100 UTSW 17 19522179 missense possibly damaging 0.46
R0109:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0111:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0112:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0149:Vmn2r100 UTSW 17 19521247 critical splice acceptor site probably null
R0355:Vmn2r100 UTSW 17 19531320 missense probably benign 0.00
R0395:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0396:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0453:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0465:Vmn2r100 UTSW 17 19531530 missense probably damaging 0.98
R0477:Vmn2r100 UTSW 17 19522514 missense probably benign 0.00
R0510:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0512:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0514:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0518:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0521:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0555:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0608:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0959:Vmn2r100 UTSW 17 19523524 missense possibly damaging 0.95
R1114:Vmn2r100 UTSW 17 19531999 missense probably damaging 1.00
R2027:Vmn2r100 UTSW 17 19522072 missense probably benign 0.02
R2049:Vmn2r100 UTSW 17 19522050 missense probably benign 0.00
R2224:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R2226:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R3618:Vmn2r100 UTSW 17 19523430 missense probably benign
R3715:Vmn2r100 UTSW 17 19532010 missense probably damaging 0.99
R4120:Vmn2r100 UTSW 17 19531953 missense probably damaging 1.00
R4152:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4153:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4154:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4200:Vmn2r100 UTSW 17 19522535 missense probably benign 0.29
R4632:Vmn2r100 UTSW 17 19531954 missense probably damaging 1.00
R4720:Vmn2r100 UTSW 17 19522526 missense probably benign 0.02
R4761:Vmn2r100 UTSW 17 19521368 missense possibly damaging 0.47
R4831:Vmn2r100 UTSW 17 19521410 missense probably benign 0.28
R4951:Vmn2r100 UTSW 17 19532038 missense probably benign 0.01
R5211:Vmn2r100 UTSW 17 19525995 missense possibly damaging 0.67
R5553:Vmn2r100 UTSW 17 19504848 missense possibly damaging 0.64
R5657:Vmn2r100 UTSW 17 19504916 missense probably benign 0.31
R5883:Vmn2r100 UTSW 17 19523524 missense probably benign
R5912:Vmn2r100 UTSW 17 19531809 missense probably damaging 0.99
R6141:Vmn2r100 UTSW 17 19522314 missense probably benign 0.07
R6146:Vmn2r100 UTSW 17 19522260 missense probably benign 0.04
R6500:Vmn2r100 UTSW 17 19522093 missense probably damaging 1.00
R6575:Vmn2r100 UTSW 17 19521409 missense probably benign 0.12
R6647:Vmn2r100 UTSW 17 19522523 missense probably benign 0.00
R7038:Vmn2r100 UTSW 17 19505001 missense possibly damaging 0.76
R7052:Vmn2r100 UTSW 17 19531294 missense possibly damaging 0.95
R7170:Vmn2r100 UTSW 17 19531971 missense probably benign 0.00
R7209:Vmn2r100 UTSW 17 19531314 missense not run
R7734:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7750:Vmn2r100 UTSW 17 19522464 missense probably benign
R8103:Vmn2r100 UTSW 17 19531153 splice site probably null
R8193:Vmn2r100 UTSW 17 19504840 nonsense probably null
R8267:Vmn2r100 UTSW 17 19522490 nonsense probably null
R8290:Vmn2r100 UTSW 17 19531350 missense probably damaging 0.99
R8531:Vmn2r100 UTSW 17 19522197 missense possibly damaging 0.66
R8786:Vmn2r100 UTSW 17 19522576 missense probably damaging 1.00
R8920:Vmn2r100 UTSW 17 19521358 missense probably damaging 1.00
R8938:Vmn2r100 UTSW 17 19531563 missense probably benign 0.00
X0062:Vmn2r100 UTSW 17 19531390 missense possibly damaging 0.89
Z1176:Vmn2r100 UTSW 17 19521530 missense probably benign 0.00
Z1177:Vmn2r100 UTSW 17 19504989 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCATACAATTCAGTCCAGATTTC -3'
(R):5'- ACCTTCTAGAGAATCAATGTCACC -3'

Sequencing Primer
(F):5'- CTATGTAAGTCCTTGGAAATTAGAGG -3'
(R):5'- AAGTCCATGTGGCTGGAA -3'
Posted On2019-06-26