Incidental Mutation 'R7313:Rprd2'
ID 567716
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Name regulation of nuclear pre-mRNA domain containing 2
Synonyms 2810036A19Rik, 6720469I21Rik, 4930535B03Rik
MMRRC Submission 045411-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.733) question?
Stock # R7313 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 95667653-95726175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 95684022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 338 (P338S)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791] [ENSMUST00000197449]
AlphaFold Q6NXI6
Predicted Effect probably damaging
Transcript: ENSMUST00000090791
AA Change: P338S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: P338S

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197449
AA Change: P320S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143240
Gene: ENSMUSG00000028106
AA Change: P320S

DomainStartEndE-ValueType
RPR 26 146 3.2e-32 SMART
coiled coil region 288 313 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200164
AA Change: P254S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,773,187 (GRCm39) N805S probably damaging Het
Acat2 A G 17: 13,178,893 (GRCm39) V60A probably benign Het
Adam6b A G 12: 113,454,754 (GRCm39) I524V probably benign Het
Adamts16 C T 13: 70,921,074 (GRCm39) W590* probably null Het
Adamts9 C T 6: 92,835,102 (GRCm39) G1257D probably damaging Het
Adgrf5 C T 17: 43,755,974 (GRCm39) T644I probably benign Het
Adgrf5 T G 17: 43,763,368 (GRCm39) probably null Het
Adgrv1 T C 13: 81,668,634 (GRCm39) T2641A possibly damaging Het
Agap3 T C 5: 24,657,382 (GRCm39) F60L probably benign Het
Akap9 C A 5: 4,054,933 (GRCm39) T1626K probably damaging Het
Ampd3 C A 7: 110,405,261 (GRCm39) D603E probably damaging Het
Angpt4 T A 2: 151,767,326 (GRCm39) V119E probably benign Het
Atp6v1a T C 16: 43,934,980 (GRCm39) T70A probably benign Het
B4galt3 T A 1: 171,100,319 (GRCm39) I163N probably damaging Het
Borcs5 C T 6: 134,687,143 (GRCm39) T167M probably damaging Het
Btbd19 T A 4: 116,978,616 (GRCm39) S156C probably damaging Het
Camkk2 C T 5: 122,875,574 (GRCm39) R492Q possibly damaging Het
Casr T C 16: 36,330,033 (GRCm39) I434V probably damaging Het
Cd4 G T 6: 124,844,066 (GRCm39) T394K probably benign Het
Cps1 T C 1: 67,237,517 (GRCm39) L1006P probably damaging Het
Crx G A 7: 15,601,857 (GRCm39) P274S probably damaging Het
Crybg1 T A 10: 43,865,107 (GRCm39) I1457F probably damaging Het
Cul4a C A 8: 13,171,676 (GRCm39) probably benign Het
D430041D05Rik T A 2: 104,085,910 (GRCm39) T196S probably benign Het
Dnah3 T C 7: 119,580,567 (GRCm39) E1995G probably benign Het
Dnm1 T A 2: 32,226,021 (GRCm39) T353S probably damaging Het
Ect2l T A 10: 18,044,149 (GRCm39) T329S probably damaging Het
Elp2 T A 18: 24,742,716 (GRCm39) S83T probably benign Het
Exosc7 A G 9: 122,948,013 (GRCm39) T39A probably benign Het
Fam135a C A 1: 24,096,473 (GRCm39) V91F probably damaging Het
Gab2 G T 7: 96,731,005 (GRCm39) probably benign Het
Gbf1 A T 19: 46,268,793 (GRCm39) I1408F possibly damaging Het
Glis3 C T 19: 28,508,419 (GRCm39) E522K probably damaging Het
Gm10375 A T 14: 43,842,314 (GRCm39) C139S possibly damaging Het
Gm26558 T C 2: 70,492,211 (GRCm39) E81G unknown Het
Gm35315 C T 5: 110,227,091 (GRCm39) C116Y probably benign Het
Gm3676 T A 14: 41,366,064 (GRCm39) I84F probably damaging Het
Gm7145 T A 1: 117,913,932 (GRCm39) H271Q probably damaging Het
Gpat2 T A 2: 127,270,215 (GRCm39) I76N probably damaging Het
Hipk1 A T 3: 103,685,574 (GRCm39) S14T unknown Het
Hlcs C A 16: 94,068,362 (GRCm39) S286I probably damaging Het
Ighg1 A T 12: 113,293,078 (GRCm39) F204Y Het
Igsf10 T C 3: 59,236,837 (GRCm39) I1115V probably benign Het
Klk7 A T 7: 43,462,299 (GRCm39) H97L probably damaging Het
Kmt2d A T 15: 98,754,504 (GRCm39) D1605E unknown Het
Leng8 T A 7: 4,142,525 (GRCm39) I49N possibly damaging Het
Lingo4 A T 3: 94,310,451 (GRCm39) D463V possibly damaging Het
Lrp1 T A 10: 127,389,337 (GRCm39) N3193I probably damaging Het
Lrrc7 T A 3: 157,866,111 (GRCm39) Y1210F probably damaging Het
Mki67 G C 7: 135,296,400 (GRCm39) A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mtcl3 T A 10: 29,072,875 (GRCm39) Y722* probably null Het
Mucl2 C T 15: 103,929,445 (GRCm39) probably null Het
Myh6 A T 14: 55,197,727 (GRCm39) D470E probably benign Het
Myo1e T C 9: 70,266,667 (GRCm39) probably null Het
Myo7a G A 7: 97,713,402 (GRCm39) R1647W probably damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nmral1 C T 16: 4,531,660 (GRCm39) M198I probably benign Het
Nrap C A 19: 56,330,700 (GRCm39) L1120F probably damaging Het
Nup155 T A 15: 8,184,406 (GRCm39) I1267N probably damaging Het
Obscn G A 11: 58,898,414 (GRCm39) P6616S unknown Het
Ocstamp T G 2: 165,239,229 (GRCm39) D319A probably damaging Het
Ooep T C 9: 78,285,433 (GRCm39) D61G probably damaging Het
Or10p1 A G 10: 129,443,949 (GRCm39) S134P probably benign Het
Or1e25 A T 11: 73,493,810 (GRCm39) I135F probably damaging Het
Or52ad1 A G 7: 102,995,538 (GRCm39) V199A probably benign Het
Or6c5c T C 10: 129,298,856 (GRCm39) S104P probably damaging Het
Or7g35 A G 9: 19,495,938 (GRCm39) Y35C probably damaging Het
Otoa A G 7: 120,701,765 (GRCm39) E148G probably benign Het
Ovgp1 A T 3: 105,894,387 (GRCm39) D720V unknown Het
Padi2 T A 4: 140,660,079 (GRCm39) F294I probably damaging Het
Pcdha7 T A 18: 37,107,471 (GRCm39) N165K probably damaging Het
Pcdhb6 C A 18: 37,468,261 (GRCm39) P394H probably damaging Het
Pcdhga6 T C 18: 37,841,072 (GRCm39) V264A possibly damaging Het
Pik3ap1 G T 19: 41,284,815 (GRCm39) D623E possibly damaging Het
Prdm10 A T 9: 31,268,456 (GRCm39) K802* probably null Het
Ptgfrn G A 3: 100,980,363 (GRCm39) L326F possibly damaging Het
Rgsl1 T G 1: 153,683,622 (GRCm39) probably null Het
Rock1 T G 18: 10,129,317 (GRCm39) T347P possibly damaging Het
Sdk1 A T 5: 141,923,377 (GRCm39) N333Y probably damaging Het
Setd4 T A 16: 93,388,132 (GRCm39) H118L probably benign Het
Sirt3 G A 7: 140,458,039 (GRCm39) P37S Het
Slc16a9 G T 10: 70,119,000 (GRCm39) G440W probably damaging Het
Slc22a23 T A 13: 34,367,161 (GRCm39) I616F probably damaging Het
Slc30a8 A C 15: 52,180,707 (GRCm39) D102A probably damaging Het
Slc6a4 T A 11: 76,901,527 (GRCm39) D87E possibly damaging Het
Slc9a4 A C 1: 40,668,663 (GRCm39) T769P probably benign Het
Sspo A T 6: 48,431,762 (GRCm39) Y685F probably damaging Het
Sspo C A 6: 48,450,390 (GRCm39) Q2560K probably benign Het
Stpg1 T A 4: 135,256,827 (GRCm39) L206Q probably damaging Het
Stt3b A T 9: 115,095,183 (GRCm39) Y283N probably damaging Het
Sult4a1 T C 15: 83,970,814 (GRCm39) E197G probably damaging Het
Syne1 T G 10: 4,997,635 (GRCm39) D444A probably damaging Het
Tex15 T A 8: 34,064,845 (GRCm39) V1425E possibly damaging Het
Tgm4 A G 9: 122,891,556 (GRCm39) D557G probably benign Het
Tmcc3 A G 10: 94,266,434 (GRCm39) probably benign Het
Tnfrsf8 T A 4: 145,000,952 (GRCm39) N385Y probably benign Het
Ttc4 T C 4: 106,536,017 (GRCm39) D15G possibly damaging Het
Tut1 A G 19: 8,941,413 (GRCm39) N400S probably benign Het
Usp39 T C 6: 72,313,413 (GRCm39) K259R probably benign Het
Vmn1r215 C T 13: 23,260,484 (GRCm39) H175Y probably benign Het
Vmn1r36 A T 6: 66,693,107 (GRCm39) M256K probably benign Het
Zfp128 T A 7: 12,624,461 (GRCm39) H276Q possibly damaging Het
Zfp276 T C 8: 123,994,562 (GRCm39) M543T probably damaging Het
Zfp354c A T 11: 50,705,483 (GRCm39) Y531N probably damaging Het
Zfp532 T A 18: 65,756,076 (GRCm39) M3K probably damaging Het
Zfp64 T G 2: 168,741,810 (GRCm39) K373Q probably damaging Het
Zfp764l1 C T 7: 126,990,856 (GRCm39) S377N probably benign Het
Zfp983 T G 17: 21,880,413 (GRCm39) S114A probably damaging Het
Zranb1 G A 7: 132,584,481 (GRCm39) R583K probably damaging Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95,672,691 (GRCm39) missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95,672,421 (GRCm39) missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95,692,416 (GRCm39) missense probably benign 0.05
IGL01022:Rprd2 APN 3 95,671,066 (GRCm39) nonsense probably null
IGL01121:Rprd2 APN 3 95,683,862 (GRCm39) missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95,683,859 (GRCm39) missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95,672,631 (GRCm39) missense probably benign
IGL01414:Rprd2 APN 3 95,672,837 (GRCm39) missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95,672,815 (GRCm39) missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95,694,622 (GRCm39) missense probably benign 0.17
R0131:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95,681,673 (GRCm39) missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95,681,669 (GRCm39) missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95,673,699 (GRCm39) missense probably benign 0.30
R0847:Rprd2 UTSW 3 95,672,725 (GRCm39) missense probably benign 0.00
R0942:Rprd2 UTSW 3 95,672,730 (GRCm39) missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95,691,559 (GRCm39) missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95,673,216 (GRCm39) missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95,725,888 (GRCm39) missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95,672,988 (GRCm39) missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95,672,047 (GRCm39) missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95,726,051 (GRCm39) unclassified probably benign
R1640:Rprd2 UTSW 3 95,671,059 (GRCm39) unclassified probably benign
R1670:Rprd2 UTSW 3 95,672,115 (GRCm39) missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95,672,107 (GRCm39) nonsense probably null
R2966:Rprd2 UTSW 3 95,673,745 (GRCm39) splice site probably null
R3612:Rprd2 UTSW 3 95,671,464 (GRCm39) missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95,671,872 (GRCm39) missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95,672,536 (GRCm39) missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95,694,686 (GRCm39) missense probably benign 0.41
R4783:Rprd2 UTSW 3 95,681,645 (GRCm39) missense probably benign 0.03
R4832:Rprd2 UTSW 3 95,681,483 (GRCm39) missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95,671,849 (GRCm39) missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95,673,661 (GRCm39) missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95,672,632 (GRCm39) missense probably benign 0.03
R5134:Rprd2 UTSW 3 95,672,632 (GRCm39) missense probably benign 0.03
R5244:Rprd2 UTSW 3 95,697,494 (GRCm39) missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95,671,401 (GRCm39) missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95,692,371 (GRCm39) missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95,672,175 (GRCm39) missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95,694,685 (GRCm39) missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95,687,753 (GRCm39) missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95,673,399 (GRCm39) missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95,681,531 (GRCm39) missense probably benign 0.00
R7064:Rprd2 UTSW 3 95,672,328 (GRCm39) missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95,673,087 (GRCm39) missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95,683,899 (GRCm39) missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95,684,105 (GRCm39) missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95,691,613 (GRCm39) missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95,671,367 (GRCm39) missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95,687,896 (GRCm39) missense probably damaging 0.99
R9030:Rprd2 UTSW 3 95,691,622 (GRCm39) missense probably benign 0.15
R9623:Rprd2 UTSW 3 95,679,505 (GRCm39) missense probably benign 0.30
RF034:Rprd2 UTSW 3 95,673,632 (GRCm39) small deletion probably benign
RF056:Rprd2 UTSW 3 95,673,631 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACATCTGAGAGTTCCATGTCTTC -3'
(R):5'- ATACCTGGGTGAGTGTTCCTC -3'

Sequencing Primer
(F):5'- ATGTCTTCCACATCACGGTTATCAG -3'
(R):5'- GTGTTCCTCATGTCACGGAAATAAGC -3'
Posted On 2019-06-26