Mutagenetix > Incidental Mutation

Incidental Mutation 'R7313:Nup155'

567786

Institutional Source

Beutler Lab

Gene Symbol

Nup155

Ensembl Gene

ENSMUSG00000022142

Gene Name

nucleoporin 155

Synonyms

D930027M19Rik

MMRRC Submission

Accession Numbers

Genbank: NM_133227

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7313 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8109273-8161247 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8154922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1267 (I1267N)

Ref Sequence

ENSEMBL: ENSMUSP00000128819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]

AlphaFold

Q99P88

Predicted Effect

probably damaging
Transcript: ENSMUST00000163765
AA Change: I1267N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: I1267N

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
Pfam:Nucleoporin_N	77	510	3.5e-105	PFAM
low complexity region	600	619	N/A	INTRINSIC
Pfam:Nucleoporin_C	678	1221	3.6e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000230017
AA Change: I1267N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	G	5: 8,723,187	N805S	probably damaging	Het
Acat2	A	G	17: 12,960,006	V60A	probably benign	Het
Adam6b	A	G	12: 113,491,134	I524V	probably benign	Het
Adamts16	C	T	13: 70,772,955	W590*	probably null	Het
Adamts9	C	T	6: 92,858,121	G1257D	probably damaging	Het
Adgrf5	C	T	17: 43,445,083	T644I	probably benign	Het
Adgrf5	T	G	17: 43,452,477		probably null	Het
Adgrv1	T	C	13: 81,520,515	T2641A	possibly damaging	Het
Agap3	T	C	5: 24,452,384	F60L	probably benign	Het
Akap9	C	A	5: 4,004,933	T1626K	probably damaging	Het
Ampd3	C	A	7: 110,806,054	D603E	probably damaging	Het
Angpt4	T	A	2: 151,925,406	V119E	probably benign	Het
Atp6v1a	T	C	16: 44,114,617	T70A	probably benign	Het
B4galt3	T	A	1: 171,272,749	I163N	probably damaging	Het
Borcs5	C	T	6: 134,710,180	T167M	probably damaging	Het
Btbd19	T	A	4: 117,121,419	S156C	probably damaging	Het
Camkk2	C	T	5: 122,737,511	R492Q	possibly damaging	Het
Casr	T	C	16: 36,509,671	I434V	probably damaging	Het
Cd4	G	T	6: 124,867,103	T394K	probably benign	Het
Cps1	T	C	1: 67,198,358	L1006P	probably damaging	Het
Crx	G	A	7: 15,867,932	P274S	probably damaging	Het
Crybg1	T	A	10: 43,989,111	I1457F	probably damaging	Het
Cul4a	C	A	8: 13,121,676		probably benign	Het
D430041D05Rik	T	A	2: 104,255,565	T196S	probably benign	Het
Dnah3	T	C	7: 119,981,344	E1995G	probably benign	Het
Dnm1	T	A	2: 32,336,009	T353S	probably damaging	Het
E430018J23Rik	C	T	7: 127,391,684	S377N	probably benign	Het
Ect2l	T	A	10: 18,168,401	T329S	probably damaging	Het
Elp2	T	A	18: 24,609,659	S83T	probably benign	Het
Exosc7	A	G	9: 123,118,948	T39A	probably benign	Het
Fam135a	C	A	1: 24,057,392	V91F	probably damaging	Het
Gab2	G	T	7: 97,081,798		probably benign	Het
Gbf1	A	T	19: 46,280,354	I1408F	possibly damaging	Het
Glis3	C	T	19: 28,531,019	E522K	probably damaging	Het
Gm10375	A	T	14: 43,604,857	C139S	possibly damaging	Het
Gm26558	T	C	2: 70,661,867	E81G	unknown	Het
Gm35315	C	T	5: 110,079,225	C116Y	probably benign	Het
Gm3676	T	A	14: 41,644,107	I84F	probably damaging	Het
Gm7145	T	A	1: 117,986,202	H271Q	probably damaging	Het
Gpat2	T	A	2: 127,428,295	I76N	probably damaging	Het
Hipk1	A	T	3: 103,778,258	S14T	unknown	Het
Hlcs	C	A	16: 94,267,503	S286I	probably damaging	Het
Ighg1	A	T	12: 113,329,458	F204Y		Het
Igsf10	T	C	3: 59,329,416	I1115V	probably benign	Het
Klk7	A	T	7: 43,812,875	H97L	probably damaging	Het
Kmt2d	A	T	15: 98,856,623	D1605E	unknown	Het
Leng8	T	A	7: 4,139,526	I49N	possibly damaging	Het
Lingo4	A	T	3: 94,403,144	D463V	possibly damaging	Het
Lrp1	T	A	10: 127,553,468	N3193I	probably damaging	Het
Lrrc7	T	A	3: 158,160,474	Y1210F	probably damaging	Het
Mki67	G	C	7: 135,694,671	A2878G	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mucl2	C	T	15: 103,899,179		probably null	Het
Myh6	A	T	14: 54,960,270	D470E	probably benign	Het
Myo1e	T	C	9: 70,359,385		probably null	Het
Myo7a	G	A	7: 98,064,195	R1647W	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nmral1	C	T	16: 4,713,796	M198I	probably benign	Het
Nrap	C	A	19: 56,342,268	L1120F	probably damaging	Het
Obscn	G	A	11: 59,007,588	P6616S	unknown	Het
Ocstamp	T	G	2: 165,397,309	D319A	probably damaging	Het
Olfr384	A	T	11: 73,602,984	I135F	probably damaging	Het
Olfr600	A	G	7: 103,346,331	V199A	probably benign	Het
Olfr787	T	C	10: 129,462,987	S104P	probably damaging	Het
Olfr796	A	G	10: 129,608,080	S134P	probably benign	Het
Olfr855	A	G	9: 19,584,642	Y35C	probably damaging	Het
Ooep	T	C	9: 78,378,151	D61G	probably damaging	Het
Otoa	A	G	7: 121,102,542	E148G	probably benign	Het
Ovgp1	A	T	3: 105,987,071	D720V	unknown	Het
Padi2	T	A	4: 140,932,768	F294I	probably damaging	Het
Pcdha7	T	A	18: 36,974,418	N165K	probably damaging	Het
Pcdhb6	C	A	18: 37,335,208	P394H	probably damaging	Het
Pcdhga6	T	C	18: 37,708,019	V264A	possibly damaging	Het
Pik3ap1	G	T	19: 41,296,376	D623E	possibly damaging	Het
Prdm10	A	T	9: 31,357,160	K802*	probably null	Het
Ptgfrn	G	A	3: 101,073,047	L326F	possibly damaging	Het
Rgsl1	T	G	1: 153,807,876		probably null	Het
Rock1	T	G	18: 10,129,317	T347P	possibly damaging	Het
Rprd2	G	A	3: 95,776,710	P338S	probably damaging	Het
Sdk1	A	T	5: 141,937,622	N333Y	probably damaging	Het
Setd4	T	A	16: 93,591,244	H118L	probably benign	Het
Sirt3	G	A	7: 140,878,126	P37S		Het
Slc16a9	G	T	10: 70,283,170	G440W	probably damaging	Het
Slc22a23	T	A	13: 34,183,178	I616F	probably damaging	Het
Slc30a8	A	C	15: 52,317,311	D102A	probably damaging	Het
Slc6a4	T	A	11: 77,010,701	D87E	possibly damaging	Het
Slc9a4	A	C	1: 40,629,503	T769P	probably benign	Het
Soga3	T	A	10: 29,196,879	Y722*	probably null	Het
Sspo	A	T	6: 48,454,828	Y685F	probably damaging	Het
Sspo	C	A	6: 48,473,456	Q2560K	probably benign	Het
Stpg1	T	A	4: 135,529,516	L206Q	probably damaging	Het
Stt3b	A	T	9: 115,266,115	Y283N	probably damaging	Het
Sult4a1	T	C	15: 84,086,613	E197G	probably damaging	Het
Syne1	T	G	10: 5,047,635	D444A	probably damaging	Het
Tex15	T	A	8: 33,574,817	V1425E	possibly damaging	Het
Tgm4	A	G	9: 123,062,491	D557G	probably benign	Het
Tmcc3	A	G	10: 94,430,572		probably benign	Het
Tnfrsf8	T	A	4: 145,274,382	N385Y	probably benign	Het
Ttc4	T	C	4: 106,678,820	D15G	possibly damaging	Het
Tut1	A	G	19: 8,964,049	N400S	probably benign	Het
Usp39	T	C	6: 72,336,430	K259R	probably benign	Het
Vmn1r215	C	T	13: 23,076,314	H175Y	probably benign	Het
Vmn1r36	A	T	6: 66,716,123	M256K	probably benign	Het
Zfp128	T	A	7: 12,890,534	H276Q	possibly damaging	Het
Zfp276	T	C	8: 123,267,823	M543T	probably damaging	Het
Zfp354c	A	T	11: 50,814,656	Y531N	probably damaging	Het
Zfp532	T	A	18: 65,623,005	M3K	probably damaging	Het
Zfp64	T	G	2: 168,899,890	K373Q	probably damaging	Het
Zfp983	T	G	17: 21,661,497	S114A	probably damaging	Het
Zranb1	G	A	7: 132,982,752	R583K	probably damaging	Het

Other mutations in Nup155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nup155	APN	15	8121455	splice site	probably benign
IGL00426:Nup155	APN	15	8156794	makesense	probably null
IGL00765:Nup155	APN	15	8153228	missense	probably benign	0.16
IGL00936:Nup155	APN	15	8128405	splice site	probably benign
IGL01124:Nup155	APN	15	8153679	missense	probably damaging	0.97
IGL01739:Nup155	APN	15	8135788	missense	probably benign	0.01
IGL02013:Nup155	APN	15	8113648	missense	possibly damaging	0.61
IGL02066:Nup155	APN	15	8157766	unclassified	probably benign
IGL02231:Nup155	APN	15	8144064	missense	probably damaging	1.00
IGL02246:Nup155	APN	15	8143002	missense	probably benign
IGL02289:Nup155	APN	15	8131493	missense	probably damaging	1.00
IGL02608:Nup155	APN	15	8109471	missense	probably benign
IGL02749:Nup155	APN	15	8134076	missense	probably damaging	1.00
IGL02813:Nup155	APN	15	8130121	splice site	probably benign
IGL03102:Nup155	APN	15	8147284	missense	probably benign	0.00
H8930:Nup155	UTSW	15	8157658	missense	possibly damaging	0.50
IGL02835:Nup155	UTSW	15	8143130	missense	probably damaging	1.00
R0314:Nup155	UTSW	15	8147252	missense	probably benign	0.00
R0365:Nup155	UTSW	15	8131543	missense	probably damaging	1.00
R0586:Nup155	UTSW	15	8130232	missense	probably benign	0.39
R0764:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R0839:Nup155	UTSW	15	8145587	missense	possibly damaging	0.48
R0844:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1066:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1067:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1085:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1137:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1162:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1166:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1202:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1203:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1219:Nup155	UTSW	15	8117338	missense	possibly damaging	0.80
R1385:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1421:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1448:Nup155	UTSW	15	8112406	missense	probably benign	0.44
R1611:Nup155	UTSW	15	8130160	missense	probably damaging	1.00
R1836:Nup155	UTSW	15	8154980	missense	possibly damaging	0.79
R1863:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1866:Nup155	UTSW	15	8115526	missense	probably damaging	1.00
R1894:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1976:Nup155	UTSW	15	8135827	missense	probably benign	0.01
R2024:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2026:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2027:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2077:Nup155	UTSW	15	8143026	missense	probably damaging	1.00
R2111:Nup155	UTSW	15	8121467	missense	probably benign	0.45
R2921:Nup155	UTSW	15	8153641	missense	probably damaging	1.00
R2936:Nup155	UTSW	15	8143049	missense	possibly damaging	0.89
R3108:Nup155	UTSW	15	8117306	missense	probably null	1.00
R3161:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3522:Nup155	UTSW	15	8156678	splice site	probably benign
R4423:Nup155	UTSW	15	8121464	missense	probably damaging	0.99
R4451:Nup155	UTSW	15	8150882	missense	probably benign	0.02
R4498:Nup155	UTSW	15	8153673	missense	possibly damaging	0.88
R4780:Nup155	UTSW	15	8157703	missense	probably benign	0.00
R4822:Nup155	UTSW	15	8128526	missense	possibly damaging	0.49
R5013:Nup155	UTSW	15	8124238	missense	probably benign	0.00
R5064:Nup155	UTSW	15	8135870	missense	probably damaging	1.00
R5172:Nup155	UTSW	15	8109542	missense	probably benign	0.06
R5406:Nup155	UTSW	15	8153638	critical splice acceptor site	probably null
R5551:Nup155	UTSW	15	8148333	missense	probably benign	0.09
R5588:Nup155	UTSW	15	8119253	critical splice donor site	probably null
R5977:Nup155	UTSW	15	8130237	critical splice donor site	probably null
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6085:Nup155	UTSW	15	8148358	missense	probably damaging	0.98
R6188:Nup155	UTSW	15	8109575	missense	probably damaging	1.00
R6232:Nup155	UTSW	15	8109479	missense	probably benign	0.02
R6257:Nup155	UTSW	15	8150798	nonsense	probably null
R6262:Nup155	UTSW	15	8156741	missense	probably benign	0.03
R6267:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6296:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6299:Nup155	UTSW	15	8128438	missense	possibly damaging	0.88
R6303:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6304:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6763:Nup155	UTSW	15	8135895	nonsense	probably null
R6958:Nup155	UTSW	15	8147154	missense	probably damaging	1.00
R7088:Nup155	UTSW	15	8156693	missense	probably benign	0.11
R7451:Nup155	UTSW	15	8145607	nonsense	probably null
R7560:Nup155	UTSW	15	8155047	missense	probably benign	0.39
R7633:Nup155	UTSW	15	8109453	missense	probably damaging	0.99
R7670:Nup155	UTSW	15	8153696	missense	probably damaging	0.99
R7726:Nup155	UTSW	15	8122139	missense	probably damaging	1.00
R7752:Nup155	UTSW	15	8116442	missense	possibly damaging	0.53
R7889:Nup155	UTSW	15	8121507	missense	probably damaging	0.98
R7899:Nup155	UTSW	15	8119179	missense	probably damaging	1.00
R7901:Nup155	UTSW	15	8116442	missense	possibly damaging	0.53
R8429:Nup155	UTSW	15	8112420	missense	probably damaging	0.96
R8467:Nup155	UTSW	15	8121531	missense	probably benign	0.00
R8507:Nup155	UTSW	15	8147560	nonsense	probably null
R8860:Nup155	UTSW	15	8130156	missense	possibly damaging	0.96
R8994:Nup155	UTSW	15	8143161	critical splice donor site	probably null
R9046:Nup155	UTSW	15	8128435	frame shift	probably null
R9086:Nup155	UTSW	15	8148346	missense	possibly damaging	0.84
R9500:Nup155	UTSW	15	8112316	missense	probably damaging	1.00
RF003:Nup155	UTSW	15	8119176	critical splice acceptor site	probably benign
RF048:Nup155	UTSW	15	8119176	critical splice acceptor site	probably benign
Z1177:Nup155	UTSW	15	8120489	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GTCCAAATTTCTGGGAAGTGATG -3'
(R):5'- TCACCTGTATCTGGGGAGATC -3'

Sequencing Primer
(F):5'- CTGGCTTAGCAATGAGAACGCTTG -3'
(R):5'- CACCTGTATCTGGGGAGATCATTTTG -3'

Posted On

2019-06-26