Incidental Mutation 'R7314:Olfr1164'
ID567813
Institutional Source Beutler Lab
Gene Symbol Olfr1164
Ensembl Gene ENSMUSG00000075136
Gene Nameolfactory receptor 1164
SynonymsMOR174-11, GA_x6K02T2Q125-49585842-49584862
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88092855-88093966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88093114 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 274 (L274P)
Ref Sequence ENSEMBL: ENSMUSP00000097422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099834]
Predicted Effect probably benign
Transcript: ENSMUST00000099834
AA Change: L274P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097422
Gene: ENSMUSG00000075136
AA Change: L274P

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 3.8e-47 PFAM
Pfam:7tm_1 53 302 2.9e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Olfr1164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr1164 APN 2 88093016 missense possibly damaging 0.48
IGL02894:Olfr1164 APN 2 88093763 missense possibly damaging 0.79
IGL02977:Olfr1164 APN 2 88093571 missense probably benign
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0480:Olfr1164 UTSW 2 88093628 missense probably benign
R0644:Olfr1164 UTSW 2 88093289 missense probably benign 0.02
R1479:Olfr1164 UTSW 2 88093286 missense probably benign 0.05
R2047:Olfr1164 UTSW 2 88093893 missense probably benign 0.01
R2311:Olfr1164 UTSW 2 88093834 missense probably benign 0.00
R2973:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R3683:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R3685:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R4258:Olfr1164 UTSW 2 88093018 missense probably damaging 1.00
R4811:Olfr1164 UTSW 2 88093532 missense probably benign 0.08
R4970:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5112:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5258:Olfr1164 UTSW 2 88093418 missense probably benign 0.22
R5884:Olfr1164 UTSW 2 88093796 missense probably damaging 1.00
R6329:Olfr1164 UTSW 2 88093664 missense probably damaging 1.00
R6597:Olfr1164 UTSW 2 88093069 missense probably damaging 1.00
R7018:Olfr1164 UTSW 2 88093256 missense probably benign 0.00
R7055:Olfr1164 UTSW 2 88093701 missense probably damaging 1.00
R7350:Olfr1164 UTSW 2 88093198 missense probably benign 0.01
R7527:Olfr1164 UTSW 2 88093610 missense probably damaging 1.00
R8003:Olfr1164 UTSW 2 88093245 nonsense probably null
Z1176:Olfr1164 UTSW 2 88093334 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAGTACATTGAATTCTGAAGAC -3'
(R):5'- GCATGCCTGGTCATTTCCATG -3'

Sequencing Primer
(F):5'- TCTGATTTTCCAATGAATATCACTCC -3'
(R):5'- CCTGGTCATTTCCATGTTTAATGAG -3'
Posted On2019-06-26