Incidental Mutation 'R7314:Cstf1'
ID567814
Institutional Source Beutler Lab
Gene Symbol Cstf1
Ensembl Gene ENSMUSG00000027498
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location172370681-172382448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172373034 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000112076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140] [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably benign
Transcript: ENSMUST00000028997
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109139
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109140
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116375
AA Change: D25G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498
AA Change: D25G

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151511
AA Change: D25G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498
AA Change: D25G

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. Similar to mammalian G protein beta subunits, this protein contains transducin-like repeats. Several transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Cstf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cstf1 APN 2 172373073 missense probably benign 0.32
IGL02306:Cstf1 APN 2 172372971 missense probably benign 0.02
IGL02553:Cstf1 APN 2 172377854 missense probably benign 0.19
IGL02756:Cstf1 APN 2 172375875 missense probably damaging 1.00
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0244:Cstf1 UTSW 2 172377710 missense possibly damaging 0.87
R1448:Cstf1 UTSW 2 172375875 missense probably damaging 1.00
R1770:Cstf1 UTSW 2 172373063 missense possibly damaging 0.59
R2055:Cstf1 UTSW 2 172380483 missense probably benign 0.00
R2146:Cstf1 UTSW 2 172375763 missense probably damaging 1.00
R3119:Cstf1 UTSW 2 172373070 missense possibly damaging 0.75
R3701:Cstf1 UTSW 2 172380392 missense probably benign 0.00
R4816:Cstf1 UTSW 2 172372985 missense probably damaging 1.00
R4893:Cstf1 UTSW 2 172380524 missense probably damaging 1.00
R4991:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R4992:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R5743:Cstf1 UTSW 2 172377833 missense probably damaging 1.00
R6386:Cstf1 UTSW 2 172377896 missense probably damaging 0.97
R7843:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
R8212:Cstf1 UTSW 2 172377952 missense probably damaging 1.00
X0026:Cstf1 UTSW 2 172375860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGGTCGCCATCCTAAG -3'
(R):5'- ATCCACATTGAAGGTACACAGGAG -3'

Sequencing Primer
(F):5'- ACACCTACTGAAGCTGAGATTG -3'
(R):5'- GGAGTGATTTCATAAACTGCCCCG -3'
Posted On2019-06-26