Incidental Mutation 'R7314:Smad9'
ID567815
Institutional Source Beutler Lab
Gene Symbol Smad9
Ensembl Gene ENSMUSG00000027796
Gene NameSMAD family member 9
SynonymsSMAD8A, MADH6, SMAD8B, Madh9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54755582-54801257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54789323 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 270 (N270D)
Ref Sequence ENSEMBL: ENSMUSP00000029371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029371]
Predicted Effect probably benign
Transcript: ENSMUST00000029371
AA Change: N270D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029371
Gene: ENSMUSG00000027796
AA Change: N270D

DomainStartEndE-ValueType
DWA 29 138 3.47e-68 SMART
DWB 234 406 1.02e-106 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that act as downstream effectors of the bone morphogenetic protein (BMP) signaling pathway. The encoded protein is phosphorylated by BMP receptors, which stimulates its binding to SMAD4 and translocation into the nucleus, where it functions as a regulator of transcription. Activity of this protein is important for embryonic development. Mutation of this gene results in defects in pulmonary vasculature. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice in which exon 3 was deleted are viable and fertile. Mutant mice in which a neo cassette is inserted in exon 3 resulting in a hypomorphic allele exhibit reduced midbrain and hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Smad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Smad9 APN 3 54786172 missense possibly damaging 0.95
IGL02666:Smad9 APN 3 54782467 missense probably damaging 1.00
IGL03346:Smad9 APN 3 54789215 missense probably benign
R1839:Smad9 UTSW 3 54789179 splice site probably benign
R1888:Smad9 UTSW 3 54789179 splice site probably benign
R3622:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3623:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3624:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3708:Smad9 UTSW 3 54786181 missense probably benign
R4469:Smad9 UTSW 3 54782761 missense probably damaging 1.00
R4756:Smad9 UTSW 3 54794453 missense possibly damaging 0.50
R4938:Smad9 UTSW 3 54789230 missense probably benign 0.00
R5139:Smad9 UTSW 3 54797406 missense possibly damaging 0.94
R5783:Smad9 UTSW 3 54794442 missense probably benign 0.15
R6200:Smad9 UTSW 3 54789186 missense probably benign
R6437:Smad9 UTSW 3 54786084 missense probably benign 0.33
R6478:Smad9 UTSW 3 54782443 missense probably damaging 1.00
R6552:Smad9 UTSW 3 54782746 missense probably damaging 1.00
R7058:Smad9 UTSW 3 54786193 missense probably benign 0.01
R7492:Smad9 UTSW 3 54786326 splice site probably null
R7683:Smad9 UTSW 3 54789264 missense probably damaging 1.00
R8278:Smad9 UTSW 3 54789266 missense probably benign 0.01
Z1177:Smad9 UTSW 3 54786222 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTGTTGCAATCGTGAGC -3'
(R):5'- AGGGCTTTCTAAAGGACCGC -3'

Sequencing Primer
(F):5'- TTGCAATCGTGAGCTCCGG -3'
(R):5'- GGCTTTCTAAAGGACCGCTTATAGC -3'
Posted On2019-06-26