Incidental Mutation 'R7314:Dnase2b'
ID567816
Institutional Source Beutler Lab
Gene Symbol Dnase2b
Ensembl Gene ENSMUSG00000028185
Gene Namedeoxyribonuclease II beta
SynonymsDlad, DnaseIIb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146580985-146615596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146582396 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 315 (I315V)
Ref Sequence ENSEMBL: ENSMUSP00000029836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029836] [ENSMUST00000199489] [ENSMUST00000200633]
Predicted Effect probably damaging
Transcript: ENSMUST00000029836
AA Change: I315V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029836
Gene: ENSMUSG00000028185
AA Change: I315V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 27 353 1.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199489
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200633
AA Change: I315V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185
AA Change: I315V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 26 353 4.5e-117 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The inability of homozygous mutant mice to degrade DNA in differentiating lens cells leads to cataract formation in the nucleus lentis. Consequently, mutant mice exhibit an impaired response to light. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Dnase2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Dnase2b APN 3 146596378 missense probably benign 0.34
IGL01626:Dnase2b APN 3 146584616 splice site probably null
IGL02582:Dnase2b APN 3 146589085 missense probably benign 0.00
IGL02970:Dnase2b APN 3 146582506 missense probably damaging 0.97
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0539:Dnase2b UTSW 3 146589155 splice site probably benign
R1544:Dnase2b UTSW 3 146584557 missense probably benign 0.03
R2201:Dnase2b UTSW 3 146584688 missense probably damaging 0.99
R3690:Dnase2b UTSW 3 146593571 nonsense probably null
R4921:Dnase2b UTSW 3 146593441 missense probably damaging 1.00
R5318:Dnase2b UTSW 3 146582455 missense probably benign 0.02
R6226:Dnase2b UTSW 3 146584563 missense probably benign
R6593:Dnase2b UTSW 3 146586911 missense probably damaging 1.00
R6781:Dnase2b UTSW 3 146582371 missense probably benign 0.40
R7035:Dnase2b UTSW 3 146582341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCGAGATGTTCCAGTGC -3'
(R):5'- ACATCTTTACAGGATGGATAGCTC -3'

Sequencing Primer
(F):5'- CCAGTGCCAGTGTTTTCAAGGAC -3'
(R):5'- CTTTACAGGATGGATAGCTCAAAAG -3'
Posted On2019-06-26