Incidental Mutation 'R7314:Map3k7'
ID567817
Institutional Source Beutler Lab
Gene Symbol Map3k7
Ensembl Gene ENSMUSG00000028284
Gene Namemitogen-activated protein kinase kinase kinase 7
SynonymsTGF-beta activated kinase 1, Tak1, transforming growth factor beta-activated kinase 1, transforming growth factor-beta-activated kinase 1, TAK1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009316.1, NM_172688.3; MGI:1346877

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location31964097-32023467 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 31985769 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 231 (E231*)
Ref Sequence ENSEMBL: ENSMUSP00000040307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037607] [ENSMUST00000080933] [ENSMUST00000108183] [ENSMUST00000108184]
Predicted Effect probably null
Transcript: ENSMUST00000037607
AA Change: E231*
SMART Domains Protein: ENSMUSP00000040307
Gene: ENSMUSG00000028284
AA Change: E231*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.2e-61 PFAM
Pfam:Pkinase 36 285 2.8e-56 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 528 593 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080933
AA Change: E231*
SMART Domains Protein: ENSMUSP00000079734
Gene: ENSMUSG00000028284
AA Change: E231*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.7e-61 PFAM
Pfam:Pkinase 36 285 8.4e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
coiled coil region 501 566 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108183
AA Change: E231*
SMART Domains Protein: ENSMUSP00000103818
Gene: ENSMUSG00000028284
AA Change: E231*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
S_TKc 36 284 1.6e-63 SMART
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108184
AA Change: E231*
SMART Domains Protein: ENSMUSP00000103819
Gene: ENSMUSG00000028284
AA Change: E231*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 5.6e-62 PFAM
Pfam:Pkinase 36 285 2.8e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype Strain: 3664194; 3608889; 3696053
Lethality: E9-E11
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis and may have impaired vascular remodeling, edema, or an open, wavy neural tube. Mice with conditional deletion in immune cells show impaired cell development and activation. [provided by MGI curators]
Allele List at MGI

All alleles(62) : Targeted(7) Gene trapped(55)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Map3k7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Map3k7 APN 4 32019539 missense probably damaging 1.00
IGL01677:Map3k7 APN 4 32017158 intron probably benign
IGL02608:Map3k7 APN 4 31981452 splice site probably benign
IGL02796:Map3k7 UTSW 4 31979692 intron probably benign
R0377:Map3k7 UTSW 4 31985731 missense probably damaging 1.00
R0498:Map3k7 UTSW 4 31974814 splice site probably benign
R1547:Map3k7 UTSW 4 31991796 missense probably benign 0.31
R2360:Map3k7 UTSW 4 31964302 missense unknown
R4709:Map3k7 UTSW 4 31985700 nonsense probably null
R4815:Map3k7 UTSW 4 31988592 missense probably damaging 0.98
R5497:Map3k7 UTSW 4 31991719 missense possibly damaging 0.56
R5813:Map3k7 UTSW 4 31964318 missense probably damaging 1.00
R6349:Map3k7 UTSW 4 31988661 missense possibly damaging 0.87
X0066:Map3k7 UTSW 4 31974848 missense probably damaging 1.00
Z1176:Map3k7 UTSW 4 32015963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCTCTTCTCCAAAATTC -3'
(R):5'- TAAGTTCTCCCCACAGGACC -3'

Sequencing Primer
(F):5'- AGTCTCTTCTCCAAAATTCCCATTC -3'
(R):5'- TTCTCCCCACAGGACCCAGAG -3'
Posted On2019-06-26