Incidental Mutation 'R7314:Tmprss11f'
ID567818
Institutional Source Beutler Lab
Gene Symbol Tmprss11f
Ensembl Gene ENSMUSG00000048764
Gene Nametransmembrane protease, serine 11f
Synonyms4732406D01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86521898-86632424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86524053 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 427 (T427A)
Ref Sequence ENSEMBL: ENSMUSP00000112252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000116553
AA Change: T427A

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112252
Gene: ENSMUSG00000048764
AA Change: T427A

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
SEA 56 168 4.62e-2 SMART
low complexity region 192 203 N/A INTRINSIC
Tryp_SPc 206 433 8.7e-84 SMART
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Tmprss11f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Tmprss11f APN 5 86524065 missense probably damaging 1.00
IGL01453:Tmprss11f APN 5 86544832 nonsense probably null
IGL02406:Tmprss11f APN 5 86533666 missense probably damaging 1.00
IGL03294:Tmprss11f APN 5 86538107 missense probably damaging 1.00
R0122:Tmprss11f UTSW 5 86533625 splice site probably benign
R0322:Tmprss11f UTSW 5 86591416 missense probably benign 0.06
R0418:Tmprss11f UTSW 5 86557011 missense probably benign 0.16
R1936:Tmprss11f UTSW 5 86544864 missense probably benign 0.23
R2002:Tmprss11f UTSW 5 86539768 splice site probably benign
R2008:Tmprss11f UTSW 5 86591406 splice site probably null
R2260:Tmprss11f UTSW 5 86591410 missense probably benign 0.22
R4109:Tmprss11f UTSW 5 86529936 missense possibly damaging 0.89
R4584:Tmprss11f UTSW 5 86539694 critical splice donor site probably null
R4983:Tmprss11f UTSW 5 86537999 missense probably benign 0.06
R5034:Tmprss11f UTSW 5 86591384 intron probably benign
R5116:Tmprss11f UTSW 5 86539696 missense probably benign 0.01
R5254:Tmprss11f UTSW 5 86538033 missense probably benign 0.00
R5324:Tmprss11f UTSW 5 86556978 missense possibly damaging 0.95
R5410:Tmprss11f UTSW 5 86530106 missense probably damaging 0.99
R5441:Tmprss11f UTSW 5 86528203 missense probably damaging 1.00
R6143:Tmprss11f UTSW 5 86539699 missense probably benign
R6178:Tmprss11f UTSW 5 86556978 missense probably benign 0.00
R6239:Tmprss11f UTSW 5 86533777 missense probably damaging 0.99
R6447:Tmprss11f UTSW 5 86528227 missense probably damaging 1.00
R6817:Tmprss11f UTSW 5 86556934 missense probably benign
R7243:Tmprss11f UTSW 5 86530116 missense probably damaging 1.00
R7623:Tmprss11f UTSW 5 86524160 missense probably damaging 1.00
R7708:Tmprss11f UTSW 5 86524169 missense probably damaging 1.00
R7776:Tmprss11f UTSW 5 86533746 missense probably benign 0.21
R7955:Tmprss11f UTSW 5 86544823 missense probably benign 0.13
R8046:Tmprss11f UTSW 5 86528273 missense probably damaging 1.00
R8147:Tmprss11f UTSW 5 86529910 missense probably damaging 1.00
R8209:Tmprss11f UTSW 5 86539707 missense probably damaging 1.00
R8219:Tmprss11f UTSW 5 86530019 missense probably damaging 1.00
R8343:Tmprss11f UTSW 5 86533807 missense probably benign 0.25
Z1176:Tmprss11f UTSW 5 86528195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCATAATGTACTATCTGCAGGC -3'
(R):5'- GAAAACGTACTTTGAGGTTCAACTC -3'

Sequencing Primer
(F):5'- AGGCATCCTGTTCCATGGG -3'
(R):5'- AGGTTCAACTCAATAGAAAGACATAC -3'
Posted On2019-06-26