Incidental Mutation 'R7314:Olfr524'
ID567826
Institutional Source Beutler Lab
Gene Symbol Olfr524
Ensembl Gene ENSMUSG00000050366
Gene Nameolfactory receptor 524
SynonymsGA_x6K02T2PBJ9-42354580-42353624, MOR103-14P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140198499-140205964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140202413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 119 (V119D)
Ref Sequence ENSEMBL: ENSMUSP00000150970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051943] [ENSMUST00000215815]
Predicted Effect probably damaging
Transcript: ENSMUST00000051943
AA Change: V119D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053565
Gene: ENSMUSG00000050366
AA Change: V119D

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.5e-56 PFAM
Pfam:7tm_1 42 292 6.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215815
AA Change: V119D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Olfr524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL01999:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02005:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02030:Olfr524 APN 7 140202632 missense probably damaging 0.97
IGL02474:Olfr524 APN 7 140202587 missense probably damaging 1.00
H8441:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
R0426:Olfr524 UTSW 7 140202116 missense possibly damaging 0.81
R0704:Olfr524 UTSW 7 140202635 missense probably benign 0.00
R0891:Olfr524 UTSW 7 140202459 missense probably damaging 1.00
R1624:Olfr524 UTSW 7 140201951 missense probably damaging 0.96
R1865:Olfr524 UTSW 7 140202372 missense probably damaging 1.00
R1938:Olfr524 UTSW 7 140202231 missense probably benign 0.30
R2105:Olfr524 UTSW 7 140202743 missense probably benign 0.02
R3009:Olfr524 UTSW 7 140202756 missense probably benign
R3546:Olfr524 UTSW 7 140202101 missense probably damaging 1.00
R4849:Olfr524 UTSW 7 140202427 nonsense probably null
R5009:Olfr524 UTSW 7 140201838 missense probably benign
R5105:Olfr524 UTSW 7 140202549 missense probably damaging 1.00
R5413:Olfr524 UTSW 7 140202722 missense possibly damaging 0.94
R5422:Olfr524 UTSW 7 140202392 missense probably damaging 1.00
R7338:Olfr524 UTSW 7 140202533 missense probably benign 0.01
R7921:Olfr524 UTSW 7 140202299 missense probably damaging 1.00
R8438:Olfr524 UTSW 7 140202257 missense probably damaging 1.00
V1662:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGAAGTGGTTCATGACGTTGG -3'
(R):5'- TCATCACAGTCATTCGCGCC -3'

Sequencing Primer
(F):5'- TTCATGACGTTGGGGCCAC -3'
(R):5'- TGCACAAGCCTATGTACCTC -3'
Posted On2019-06-26