Incidental Mutation 'R7314:Lca5'
ID567831
Institutional Source Beutler Lab
Gene Symbol Lca5
Ensembl Gene ENSMUSG00000032258
Gene NameLeber congenital amaurosis 5 (human)
Synonyms4930431B11Rik, 5730406O13Rik, ORF64
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location83390293-83441127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83395510 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 594 (K594E)
Ref Sequence ENSEMBL: ENSMUSP00000034791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034791
AA Change: K594E

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: K594E

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 103 295 2.6e-66 PFAM
low complexity region 306 315 N/A INTRINSIC
low complexity region 617 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034793
SMART Domains Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 4.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190514
SMART Domains Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 5.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Lca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Lca5 APN 9 83395475 missense probably damaging 0.98
IGL01349:Lca5 APN 9 83426617 missense probably damaging 1.00
IGL01918:Lca5 APN 9 83423148 missense probably damaging 1.00
IGL02035:Lca5 APN 9 83423312 missense probably damaging 1.00
IGL02276:Lca5 APN 9 83398585 missense possibly damaging 0.79
IGL02425:Lca5 APN 9 83399721 missense probably damaging 1.00
IGL02481:Lca5 APN 9 83423117 missense probably damaging 1.00
IGL02483:Lca5 APN 9 83423117 missense probably damaging 1.00
R0465:Lca5 UTSW 9 83395867 nonsense probably null
R0610:Lca5 UTSW 9 83399739 missense probably benign 0.24
R0811:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0812:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0968:Lca5 UTSW 9 83423169 missense probably benign 0.01
R1891:Lca5 UTSW 9 83395608 missense probably damaging 1.00
R5223:Lca5 UTSW 9 83398613 missense probably benign 0.00
R5235:Lca5 UTSW 9 83423054 nonsense probably null
R5260:Lca5 UTSW 9 83423223 missense probably damaging 0.98
R5531:Lca5 UTSW 9 83398595 missense probably benign 0.00
R5558:Lca5 UTSW 9 83401743 missense probably damaging 0.99
R5688:Lca5 UTSW 9 83398566 missense probably benign 0.01
R5886:Lca5 UTSW 9 83399681 missense probably benign 0.31
R6426:Lca5 UTSW 9 83395654 nonsense probably null
R7108:Lca5 UTSW 9 83423169 missense probably benign 0.25
R7151:Lca5 UTSW 9 83398640 missense probably benign 0.20
R7378:Lca5 UTSW 9 83395530 missense probably benign 0.00
R7468:Lca5 UTSW 9 83423456 missense probably damaging 0.99
R7686:Lca5 UTSW 9 83395239 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTCCCCAGAGAGGAAATG -3'
(R):5'- TCGTTTAATGGACAACACTTGCAG -3'

Sequencing Primer
(F):5'- ATGAAGAGGGTCCATGTCACCTC -3'
(R):5'- TGGACAACACTTGCAGGACTTG -3'
Posted On2019-06-26