Incidental Mutation 'R7314:Lingo3'
ID567833
Institutional Source Beutler Lab
Gene Symbol Lingo3
Ensembl Gene ENSMUSG00000051067
Gene Nameleucine rich repeat and Ig domain containing 3
SynonymsLERN2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80832801-80844039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80834873 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 408 (I408V)
Ref Sequence ENSEMBL: ENSMUSP00000054960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053986] [ENSMUST00000219924]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053986
AA Change: I408V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054960
Gene: ENSMUSG00000051067
AA Change: I408V

DomainStartEndE-ValueType
LRRNT 23 57 1.54e-5 SMART
LRR_TYP 76 99 1.38e-3 SMART
LRR_TYP 100 123 4.94e-5 SMART
LRR 124 147 3.86e0 SMART
LRR 148 171 4.98e-1 SMART
LRR 172 195 1.62e1 SMART
LRR 246 267 3.46e2 SMART
LRR 269 291 3.86e0 SMART
LRR 292 315 3.24e0 SMART
LRR 316 339 4.34e-1 SMART
LRRCT 351 404 7.18e-3 SMART
IGc2 419 486 3.12e-14 SMART
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Lingo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lingo3 APN 10 80835313 missense probably damaging 1.00
IGL02120:Lingo3 APN 10 80835859 missense probably damaging 1.00
IGL02755:Lingo3 APN 10 80836009 missense possibly damaging 0.49
IGL02938:Lingo3 APN 10 80835154 missense probably benign 0.00
IGL02945:Lingo3 APN 10 80834698 missense probably damaging 1.00
IGL03167:Lingo3 APN 10 80835344 missense probably damaging 1.00
R0639:Lingo3 UTSW 10 80835784 missense probably benign 0.11
R0645:Lingo3 UTSW 10 80835335 missense probably benign 0.00
R0673:Lingo3 UTSW 10 80835784 missense probably benign 0.11
R1250:Lingo3 UTSW 10 80834771 missense probably benign 0.05
R1521:Lingo3 UTSW 10 80835721 missense probably benign
R1794:Lingo3 UTSW 10 80835598 missense probably benign 0.19
R4665:Lingo3 UTSW 10 80835538 missense probably damaging 1.00
R5587:Lingo3 UTSW 10 80835530 missense probably damaging 0.98
R6458:Lingo3 UTSW 10 80835316 missense probably damaging 1.00
R7082:Lingo3 UTSW 10 80835791 missense probably benign
R7231:Lingo3 UTSW 10 80835104 missense possibly damaging 0.86
R7390:Lingo3 UTSW 10 80834629 missense probably damaging 1.00
R7450:Lingo3 UTSW 10 80834837 nonsense probably null
R7650:Lingo3 UTSW 10 80835763 missense probably damaging 1.00
R7894:Lingo3 UTSW 10 80834776 nonsense probably null
R7920:Lingo3 UTSW 10 80834548 missense probably benign 0.09
R8070:Lingo3 UTSW 10 80836121 start gained probably benign
R8095:Lingo3 UTSW 10 80835421 missense probably benign 0.01
R8171:Lingo3 UTSW 10 80834761 missense probably benign
R8178:Lingo3 UTSW 10 80834630 missense possibly damaging 0.80
R8425:Lingo3 UTSW 10 80834982 missense probably benign 0.04
Z1176:Lingo3 UTSW 10 80834855 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACATGTGTAGGTGCCACTGTC -3'
(R):5'- CATTCCACTCGGTGAACACG -3'

Sequencing Primer
(F):5'- TAGGTGCCACTGTCCTGGG -3'
(R):5'- TCGGTGAACACGCTCGAGAC -3'
Posted On2019-06-26