Incidental Mutation 'R7314:Krt16'
ID567835
Institutional Source Beutler Lab
Gene Symbol Krt16
Ensembl Gene ENSMUSG00000053797
Gene Namekeratin 16
SynonymsKrt1-16, K16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100246091-100248902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100247869 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 197 (D197G)
Ref Sequence ENSEMBL: ENSMUSP00000007280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007280]
Predicted Effect probably damaging
Transcript: ENSMUST00000007280
AA Change: D197G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007280
Gene: ENSMUSG00000053797
AA Change: D197G

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 112 423 8.41e-170 SMART
low complexity region 454 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin and acts as an innate immune system effector, promoting the inflammatory response upon breach of the skin barrier. Defects in this gene are a cause of pachyonychia congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal and postnatal lethality, decreased body weight, abnormal tongue epithelium and hyperkertotic calluses in areas of physical pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Krt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Krt16 APN 11 100248717 nonsense probably null
IGL01794:Krt16 APN 11 100247905 missense probably benign 0.00
IGL01795:Krt16 APN 11 100247724 splice site probably benign
IGL02221:Krt16 APN 11 100246336 splice site probably benign
IGL02243:Krt16 APN 11 100246336 splice site probably benign
IGL02410:Krt16 APN 11 100246336 splice site probably benign
IGL02451:Krt16 APN 11 100246336 splice site probably benign
IGL02457:Krt16 APN 11 100246336 splice site probably benign
IGL02512:Krt16 APN 11 100246336 splice site probably benign
IGL02745:Krt16 APN 11 100246336 splice site probably benign
IGL02867:Krt16 APN 11 100247576 missense probably damaging 1.00
PIT4131001:Krt16 UTSW 11 100248749 missense unknown
PIT4472001:Krt16 UTSW 11 100247906 missense probably benign 0.04
R0268:Krt16 UTSW 11 100246525 splice site probably benign
R0709:Krt16 UTSW 11 100246454 splice site probably benign
R1560:Krt16 UTSW 11 100246649 missense probably damaging 1.00
R1728:Krt16 UTSW 11 100247707 missense probably damaging 1.00
R1996:Krt16 UTSW 11 100248788 missense unknown
R2927:Krt16 UTSW 11 100248799 missense unknown
R3806:Krt16 UTSW 11 100248740 missense unknown
R3907:Krt16 UTSW 11 100247163 missense possibly damaging 0.83
R5133:Krt16 UTSW 11 100247631 missense probably damaging 0.99
R5412:Krt16 UTSW 11 100246767 missense probably damaging 1.00
R5723:Krt16 UTSW 11 100248446 missense probably damaging 0.99
R6270:Krt16 UTSW 11 100247203 missense possibly damaging 0.51
R6368:Krt16 UTSW 11 100246676 missense probably damaging 1.00
R7191:Krt16 UTSW 11 100246658 missense probably damaging 1.00
R7446:Krt16 UTSW 11 100246784 frame shift probably null
R7825:Krt16 UTSW 11 100248634 missense unknown
R7852:Krt16 UTSW 11 100246766 missense probably damaging 1.00
R8053:Krt16 UTSW 11 100246787 missense probably damaging 1.00
R8251:Krt16 UTSW 11 100248370 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGCTCATTCTCGTACCTG -3'
(R):5'- GCACGTGCATATAACTTGAGCTG -3'

Sequencing Primer
(F):5'- CTCATTCTCGTACCTGGAAGGAGAG -3'
(R):5'- ACGTGCATATAACTTGAGCTGTGTAG -3'
Posted On2019-06-26