Incidental Mutation 'R7314:Ghdc'
ID567836
Institutional Source Beutler Lab
Gene Symbol Ghdc
Ensembl Gene ENSMUSG00000017747
Gene NameGH3 domain containing
SynonymsD11Lgp1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100766032-100770957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100769102 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 273 (E273G)
Ref Sequence ENSEMBL: ENSMUSP00000017891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017891] [ENSMUST00000139341]
Predicted Effect probably damaging
Transcript: ENSMUST00000017891
AA Change: E273G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017891
Gene: ENSMUSG00000017747
AA Change: E273G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Pfam:GH3 177 519 1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139341
SMART Domains Protein: ENSMUSP00000114260
Gene: ENSMUSG00000017747

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Ghdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1489:Ghdc UTSW 11 100768257 missense probably benign 0.39
R1568:Ghdc UTSW 11 100768505 missense probably benign 0.03
R1945:Ghdc UTSW 11 100769205 missense probably benign 0.10
R1999:Ghdc UTSW 11 100769192 missense probably benign 0.04
R2150:Ghdc UTSW 11 100769192 missense probably benign 0.04
R4779:Ghdc UTSW 11 100770103 missense possibly damaging 0.93
R4807:Ghdc UTSW 11 100770225 missense probably damaging 1.00
R4910:Ghdc UTSW 11 100766988 missense probably benign 0.26
R4952:Ghdc UTSW 11 100769151 missense probably damaging 1.00
R5001:Ghdc UTSW 11 100766834 missense probably damaging 1.00
R5220:Ghdc UTSW 11 100769717 missense probably damaging 0.98
R5422:Ghdc UTSW 11 100769194 missense probably benign 0.03
R5926:Ghdc UTSW 11 100768237 missense possibly damaging 0.78
R6165:Ghdc UTSW 11 100769102 missense possibly damaging 0.70
R7076:Ghdc UTSW 11 100769714 missense possibly damaging 0.75
R7299:Ghdc UTSW 11 100768116 missense possibly damaging 0.47
R7655:Ghdc UTSW 11 100769667 missense probably benign 0.04
R7656:Ghdc UTSW 11 100769667 missense probably benign 0.04
Z1176:Ghdc UTSW 11 100769417 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGGCTGTTAGTCAGAGCTAG -3'
(R):5'- GCTGATGGTGAAGAACTGGC -3'

Sequencing Primer
(F):5'- GCTGTTAGTCAGAGCTAGTAACCC -3'
(R):5'- CTGAGGCCATAGCAGCTG -3'
Posted On2019-06-26