Incidental Mutation 'R7314:Zfp369'
ID567839
Institutional Source Beutler Lab
Gene Symbol Zfp369
Ensembl Gene ENSMUSG00000021514
Gene Namezinc finger protein 369
SynonymsB930030B22Rik, NRIF2, D230020H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location65278814-65304221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65292104 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 201 (S201P)
Ref Sequence ENSEMBL: ENSMUSP00000119114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126879] [ENSMUST00000130799]
Predicted Effect probably damaging
Transcript: ENSMUST00000126879
AA Change: S201P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119114
Gene: ENSMUSG00000021514
AA Change: S201P

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 367 1.63e-14 SMART
low complexity region 440 452 N/A INTRINSIC
ZnF_C2H2 701 723 5.42e-2 SMART
ZnF_C2H2 729 751 4.79e-3 SMART
ZnF_C2H2 757 779 1.47e-3 SMART
ZnF_C2H2 785 807 2.43e-4 SMART
ZnF_C2H2 813 835 6.88e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130799
AA Change: S201P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116221
Gene: ENSMUSG00000021514
AA Change: S201P

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 354 3.54e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Other mutations in Zfp369
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfp369 APN 13 65297260 missense probably benign 0.41
IGL01393:Zfp369 APN 13 65294474 missense possibly damaging 0.85
IGL02277:Zfp369 APN 13 65284932 missense probably damaging 1.00
IGL02986:Zfp369 APN 13 65280281 missense probably damaging 1.00
IGL02992:Zfp369 APN 13 65294451 missense possibly damaging 0.50
IGL03170:Zfp369 APN 13 65294410 missense probably damaging 0.99
IGL03351:Zfp369 APN 13 65296153 missense possibly damaging 0.95
R0136:Zfp369 UTSW 13 65297202 missense probably benign 0.08
R0600:Zfp369 UTSW 13 65296434 missense probably damaging 0.97
R0646:Zfp369 UTSW 13 65297548 missense probably damaging 1.00
R1190:Zfp369 UTSW 13 65292293 missense probably damaging 0.99
R1191:Zfp369 UTSW 13 65291962 nonsense probably null
R1528:Zfp369 UTSW 13 65292165 missense probably damaging 1.00
R1934:Zfp369 UTSW 13 65297151 missense probably damaging 1.00
R2168:Zfp369 UTSW 13 65296948 missense probably benign 0.01
R4386:Zfp369 UTSW 13 65296992 missense probably benign 0.00
R4928:Zfp369 UTSW 13 65296800 missense possibly damaging 0.91
R5127:Zfp369 UTSW 13 65279033 start gained probably benign
R5549:Zfp369 UTSW 13 65297380 missense probably damaging 1.00
R5740:Zfp369 UTSW 13 65296767 missense probably benign
R5743:Zfp369 UTSW 13 65295680 missense probably benign 0.02
R5840:Zfp369 UTSW 13 65297278 missense possibly damaging 0.46
R6351:Zfp369 UTSW 13 65296230 missense possibly damaging 0.83
R7248:Zfp369 UTSW 13 65296117 missense probably damaging 0.98
R7288:Zfp369 UTSW 13 65285018 critical splice donor site probably null
R7470:Zfp369 UTSW 13 65292146 missense probably benign 0.12
R7508:Zfp369 UTSW 13 65279273 missense unknown
R7796:Zfp369 UTSW 13 65296215 missense probably benign
R7886:Zfp369 UTSW 13 65292054 missense possibly damaging 0.95
R8425:Zfp369 UTSW 13 65296675 missense possibly damaging 0.96
Z1177:Zfp369 UTSW 13 65292160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTGAACAAGGATATGGCTGGTC -3'
(R):5'- TCACCATCGTCCTTAGACACTG -3'

Sequencing Primer
(F):5'- ATATGGCTGGTCCCCGGAATG -3'
(R):5'- ATCGTCCTTAGACACTGAGGTC -3'
Posted On2019-06-26