Incidental Mutation 'R7314:Jph4'
ID567842
Institutional Source Beutler Lab
Gene Symbol Jph4
Ensembl Gene ENSMUSG00000022208
Gene Namejunctophilin 4
SynonymsJPHL1, JP-4, 9330157P13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7314 (G1)
Quality Score217.468
Status Validated
Chromosome14
Chromosomal Location55106826-55116935 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCCATTCTCGTATACCCCA to TCCA at 55109739 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022819] [ENSMUST00000036041] [ENSMUST00000124493] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000151314] [ENSMUST00000170285]
Predicted Effect probably benign
Transcript: ENSMUST00000022819
SMART Domains Protein: ENSMUSP00000022819
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036041
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124493
SMART Domains Protein: ENSMUSP00000121893
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170285
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the junctophilin family of transmembrane proteins that are involved in the formation of the junctional membrane complexes between the plasma membrane and the endoplasmic/sarcoplasmic reticulum in excitable cells. The encoded protein contains a conserved N-terminal repeat region called the membrane occupation and recognition nexus sequence that is found in other members of the junctophilin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Jph4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0108:Jph4 UTSW 14 55109300 missense probably benign 0.43
R0142:Jph4 UTSW 14 55108326 missense probably benign 0.23
R0332:Jph4 UTSW 14 55114010 missense possibly damaging 0.61
R1610:Jph4 UTSW 14 55114103 missense probably damaging 0.99
R1829:Jph4 UTSW 14 55114911 missense probably damaging 0.99
R1912:Jph4 UTSW 14 55108361 missense probably benign 0.38
R2157:Jph4 UTSW 14 55113527 missense probably benign 0.01
R4073:Jph4 UTSW 14 55115040 missense probably benign 0.00
R4569:Jph4 UTSW 14 55115046 missense probably damaging 0.96
R4796:Jph4 UTSW 14 55109708 missense probably damaging 1.00
R6220:Jph4 UTSW 14 55110085 missense probably benign 0.05
R7188:Jph4 UTSW 14 55115207 missense probably damaging 0.99
R7814:Jph4 UTSW 14 55109735 missense probably damaging 1.00
R8182:Jph4 UTSW 14 55109756 missense possibly damaging 0.82
X0020:Jph4 UTSW 14 55114971 missense probably damaging 1.00
X0061:Jph4 UTSW 14 55113611 missense probably damaging 1.00
X0067:Jph4 UTSW 14 55109383 missense probably benign 0.00
Z1176:Jph4 UTSW 14 55113648 missense probably benign 0.04
Z1177:Jph4 UTSW 14 55114926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCAGCTAGTTCCTCTGC -3'
(R):5'- AGGGTGTCTTGGAGGTAGAACC -3'

Sequencing Primer
(F):5'- AGCTAGTTCCTCTGCCTGCTC -3'
(R):5'- GTAATGGAAGGTTGGAGGTATCC -3'
Posted On2019-06-26