Incidental Mutation 'R7314:Lgi3'
ID567843
Institutional Source Beutler Lab
Gene Symbol Lgi3
Ensembl Gene ENSMUSG00000033595
Gene Nameleucine-rich repeat LGI family, member 3
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_145219.4; MGI: 2182619

Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70530685-70538324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70532112 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 84 (F84S)
Ref Sequence ENSEMBL: ENSMUSP00000046705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047331] [ENSMUST00000226548]
Predicted Effect probably damaging
Transcript: ENSMUST00000047331
AA Change: F84S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046705
Gene: ENSMUSG00000033595
AA Change: F84S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 47 N/A INTRINSIC
LRR 87 110 2.63e0 SMART
LRR 111 134 1.07e0 SMART
LRR_TYP 135 158 2.84e-5 SMART
LRRCT 170 219 2.76e-4 SMART
Pfam:EPTP 222 263 7.6e-13 PFAM
Pfam:EPTP 268 309 1.3e-12 PFAM
Pfam:EPTP 314 360 1.1e-14 PFAM
Pfam:EPTP 363 405 2.4e-9 PFAM
Pfam:EPTP 410 452 1.2e-11 PFAM
Pfam:EPTP 455 496 2.2e-12 PFAM
Pfam:EPTP 501 541 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226548
AA Change: F84S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9466 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Lgi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Lgi3 APN 14 70533385 missense probably benign 0.05
IGL02203:Lgi3 APN 14 70534518 missense possibly damaging 0.68
P0007:Lgi3 UTSW 14 70536712 missense probably damaging 1.00
R0114:Lgi3 UTSW 14 70531029 start gained probably benign
R0225:Lgi3 UTSW 14 70532821 missense probably benign
R0242:Lgi3 UTSW 14 70534815 nonsense probably null
R0242:Lgi3 UTSW 14 70534815 nonsense probably null
R0244:Lgi3 UTSW 14 70534698 missense probably benign 0.30
R0396:Lgi3 UTSW 14 70534840 missense probably damaging 1.00
R0479:Lgi3 UTSW 14 70534552 unclassified probably benign
R1652:Lgi3 UTSW 14 70531216 missense probably damaging 0.99
R1840:Lgi3 UTSW 14 70534776 splice site probably null
R1930:Lgi3 UTSW 14 70536268 missense probably damaging 0.98
R1931:Lgi3 UTSW 14 70536268 missense probably damaging 0.98
R2474:Lgi3 UTSW 14 70533249 critical splice donor site probably null
R4672:Lgi3 UTSW 14 70534457 missense possibly damaging 0.62
R5979:Lgi3 UTSW 14 70536460 missense probably damaging 1.00
R6385:Lgi3 UTSW 14 70531170 missense possibly damaging 0.66
R7146:Lgi3 UTSW 14 70533392 missense probably damaging 1.00
R7712:Lgi3 UTSW 14 70531111 missense unknown
R8124:Lgi3 UTSW 14 70534738 missense probably damaging 1.00
R8417:Lgi3 UTSW 14 70534806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTGGCTGAGAGGGAAGG -3'
(R):5'- CGGACTCCTGACCTCATGTC -3'

Sequencing Primer
(F):5'- ACTGTCGCTTCTGGAGGC -3'
(R):5'- GACCTCATGTCACTCCACC -3'
Posted On2019-06-26