Incidental Mutation 'R7314:Hspbap1'
ID567845
Institutional Source Beutler Lab
Gene Symbol Hspbap1
Ensembl Gene ENSMUSG00000022849
Gene NameHspb associated protein 1
Synonyms3830421G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35770375-35828477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35825171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 409 (S409T)
Ref Sequence ENSEMBL: ENSMUSP00000156217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023555] [ENSMUST00000231579]
Predicted Effect probably benign
Transcript: ENSMUST00000023555
SMART Domains Protein: ENSMUSP00000023555
Gene: ENSMUSG00000022849

DomainStartEndE-ValueType
JmjC 126 288 1.29e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231579
AA Change: S409T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to one of the small heat shock proteins, specifically hsp27. Hsp27 is involved with cell growth and differentiation. This encoded protein was found to be abnormally expressed in patients with intractable epilepsy, although how brain function is affected remains unknown. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Hspbap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hspbap1 APN 16 35814061 splice site probably benign
IGL01377:Hspbap1 APN 16 35825311 missense possibly damaging 0.48
IGL03070:Hspbap1 APN 16 35818726 missense probably damaging 0.96
R1099:Hspbap1 UTSW 16 35824944 missense probably damaging 0.99
R1346:Hspbap1 UTSW 16 35801665 missense probably damaging 1.00
R1532:Hspbap1 UTSW 16 35825303 missense probably damaging 1.00
R1848:Hspbap1 UTSW 16 35818764 critical splice donor site probably null
R1867:Hspbap1 UTSW 16 35801564 missense possibly damaging 0.77
R4512:Hspbap1 UTSW 16 35787241 missense probably damaging 0.98
R4718:Hspbap1 UTSW 16 35787322 missense probably benign 0.07
R5553:Hspbap1 UTSW 16 35801597 missense probably damaging 1.00
R5590:Hspbap1 UTSW 16 35801663 missense probably damaging 1.00
R6151:Hspbap1 UTSW 16 35817222 missense probably damaging 1.00
R6612:Hspbap1 UTSW 16 35801591 missense probably damaging 1.00
R7253:Hspbap1 UTSW 16 35817230 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTTGCAAGTGCTGAGC -3'
(R):5'- TTGTATCAAAAGCTGGGCCACC -3'

Sequencing Primer
(F):5'- GCTGAGCGCAAACGGGG -3'
(R):5'- CATCCTGGTTACTTGTGGATTAAC -3'
Posted On2019-06-26