Mutagenetix > Incidental Mutation

Incidental Mutation 'R7315:Cst7'

567861

Institutional Source

Beutler Lab

Gene Symbol

Cst7

Ensembl Gene

ENSMUSG00000068129

Gene Name

cystatin F (leukocystatin)

Synonyms

cystatin-like metastasis-associated protein, CMAP, Leukocystatin

MMRRC Submission

045368-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7315 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

150570415-150578944 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 150570583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 22 (P22Q)

Ref Sequence

ENSEMBL: ENSMUSP00000086606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089200]

AlphaFold

O89098

Predicted Effect

probably benign
Transcript: ENSMUST00000089200
AA Change: P22Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000086606
Gene: ENSMUSG00000068129
AA Change: P22Q

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CY	33	144	1.04e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	C	7: 120,294,118 (GRCm38)	I1264L	probably benign	Het
Abcg8	C	A	17: 84,696,714 (GRCm38)	D484E	probably damaging	Het
Abhd13	T	A	8: 9,987,970 (GRCm38)	L189H	probably damaging	Het
Acox2	T	C	14: 8,256,139 (GRCm38)	D60G	probably damaging	Het
Acp3	A	G	9: 104,316,224 (GRCm38)		probably null	Het
Agpat4	C	T	17: 12,210,298 (GRCm38)	R146C	probably damaging	Het
Antxrl	T	C	14: 34,071,547 (GRCm38)	S411P	unknown	Het
B4galt5	A	G	2: 167,301,376 (GRCm38)	V376A	probably damaging	Het
Camk1d	T	C	2: 5,339,230 (GRCm38)	Y198C	probably damaging	Het
Cd1d1	C	T	3: 86,998,113 (GRCm38)	R191H	possibly damaging	Het
Cd93	A	G	2: 148,442,541 (GRCm38)	V295A	probably damaging	Het
Cdc27	G	A	11: 104,515,444 (GRCm38)	T615I	possibly damaging	Het
Cfap74	T	C	4: 155,463,019 (GRCm38)	Y1221H	unknown	Het
Col24a1	G	A	3: 145,431,870 (GRCm38)	S896N	possibly damaging	Het
Crppa	A	G	12: 36,390,374 (GRCm38)	T94A	probably benign	Het
Dnah6	C	T	6: 73,084,760 (GRCm38)	A2781T	probably damaging	Het
Dscaml1	G	A	9: 45,745,125 (GRCm38)	A1588T	probably benign	Het
Dsg2	A	T	18: 20,579,160 (GRCm38)	I118F	probably damaging	Het
Eif1ad2	A	G	12: 87,819,703 (GRCm38)	E128G	unknown	Het
Eme2	G	A	17: 24,894,866 (GRCm38)	R62W	probably damaging	Het
Epha3	A	T	16: 63,552,609 (GRCm38)	D910E	probably benign	Het
Ext1	T	C	15: 53,073,387 (GRCm38)	D654G	probably damaging	Het
Fnip2	A	G	3: 79,506,205 (GRCm38)		probably null	Het
Gon4l	T	A	3: 88,895,179 (GRCm38)	H1032Q	probably benign	Het
Kitl	G	A	10: 100,016,112 (GRCm38)	R31H	unknown	Het
Lcp2	G	A	11: 34,069,906 (GRCm38)		probably null	Het
Lrp2	T	C	2: 69,491,822 (GRCm38)	H1921R	probably damaging	Het
Lvrn	A	G	18: 46,876,984 (GRCm38)	T400A	probably benign	Het
Mak16	G	A	8: 31,164,738 (GRCm38)	R143*	probably null	Het
Mettl23	A	G	11: 116,849,102 (GRCm38)	I159V	probably benign	Het
Mr1	T	C	1: 155,129,290 (GRCm38)	N335D	probably benign	Het
Muc2	T	C	7: 141,690,402 (GRCm38)	C12R	probably damaging	Het
Myom1	T	C	17: 71,080,897 (GRCm38)		probably null	Het
Nav2	A	G	7: 49,548,289 (GRCm38)	N33S	possibly damaging	Het
Ninl	A	G	2: 150,950,050 (GRCm38)	V851A	probably benign	Het
Nmt1	A	G	11: 103,060,183 (GRCm38)	N367D	probably benign	Het
Noc2l	T	G	4: 156,241,360 (GRCm38)	S354R	probably damaging	Het
Opn1sw	A	T	6: 29,379,363 (GRCm38)	I214N	probably damaging	Het
Or12d14-ps1	G	T	17: 37,362,660 (GRCm38)	C181F	probably damaging	Het
Or13e8	T	A	4: 43,696,961 (GRCm38)	I71F	probably damaging	Het
Or14c40	T	C	7: 86,664,237 (GRCm38)	S192P	probably damaging	Het
Or4k52	T	C	2: 111,780,659 (GRCm38)	V113A	probably damaging	Het
Or5ac16	A	G	16: 59,202,133 (GRCm38)	F98L	probably benign	Het
Or7e169	G	T	9: 19,845,835 (GRCm38)	S261R	probably damaging	Het
Or8a1	T	C	9: 37,730,576 (GRCm38)	M136V	probably benign	Het
Or8b9	A	T	9: 37,855,247 (GRCm38)	Y143F	probably benign	Het
Papss2	T	C	19: 32,639,225 (GRCm38)	V217A	possibly damaging	Het
Pes1	A	G	11: 3,976,085 (GRCm38)	I291M	probably benign	Het
Ptprb	T	A	10: 116,362,379 (GRCm38)	I1660N	possibly damaging	Het
Rapgef1	C	A	2: 29,734,492 (GRCm38)	T1030K	probably damaging	Het
Rassf8	A	G	6: 145,815,751 (GRCm38)	M268V	probably benign	Het
Rbl2	A	T	8: 91,076,012 (GRCm38)	T154S	probably damaging	Het
Rgs1	A	G	1: 144,248,899 (GRCm38)		probably null	Het
Rpgrip1	C	T	14: 52,121,001 (GRCm38)	T188I	not run	Het
Rrp1b	T	A	17: 32,058,571 (GRCm38)	F608L	probably benign	Het
Sbp	C	T	17: 23,945,306 (GRCm38)	A154V	probably benign	Het
Scara3	C	T	14: 65,931,440 (GRCm38)	E243K	probably damaging	Het
Serpinb6b	A	T	13: 32,972,257 (GRCm38)	D110V	probably benign	Het
Skic2	T	A	17: 34,841,169 (GRCm38)	D875V	probably benign	Het
Slc2a4	G	C	11: 69,946,433 (GRCm38)	T59R	probably damaging	Het
Slc4a1	A	G	11: 102,356,484 (GRCm38)	S462P	probably damaging	Het
Slc66a1	G	A	4: 139,301,870 (GRCm38)	T101M	probably damaging	Het
Snx33	C	T	9: 56,925,867 (GRCm38)	R306H	probably damaging	Het
Srf	T	C	17: 46,551,794 (GRCm38)		probably null	Het
Steap3	A	G	1: 120,227,912 (GRCm38)	V439A	probably benign	Het
Syt10	C	T	15: 89,814,338 (GRCm38)	D268N	probably damaging	Het
Tent5b	C	T	4: 133,487,084 (GRCm38)	T422I	probably damaging	Het
Terf2	T	C	8: 107,081,217 (GRCm38)	N242S	probably benign	Het
Tex15	A	G	8: 33,581,516 (GRCm38)	T2364A	probably benign	Het
Tgfbr2	A	T	9: 116,109,738 (GRCm38)	H365Q	possibly damaging	Het
Tnrc6c	T	G	11: 117,723,528 (GRCm38)	N837K	probably benign	Het
Trim67	T	A	8: 124,794,330 (GRCm38)	S144T	probably benign	Het
Zc3hav1l	T	G	6: 38,295,147 (GRCm38)	D229A	possibly damaging	Het
Zmym4	A	T	4: 126,882,592 (GRCm38)	V1184E	probably benign	Het

Other mutations in Cst7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0166:Cst7	UTSW	2	150,575,727 (GRCm38)	missense	probably benign	0.01
R0530:Cst7	UTSW	2	150,570,515 (GRCm38)	start gained	probably benign
R0606:Cst7	UTSW	2	150,570,519 (GRCm38)	start codon destroyed	probably benign	0.08
R0620:Cst7	UTSW	2	150,575,886 (GRCm38)	splice site	probably benign
R1856:Cst7	UTSW	2	150,577,708 (GRCm38)	missense	probably damaging	1.00
R5556:Cst7	UTSW	2	150,570,568 (GRCm38)	missense	probably benign
R7487:Cst7	UTSW	2	150,577,704 (GRCm38)	missense	probably benign	0.07
R7509:Cst7	UTSW	2	150,577,704 (GRCm38)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGAAGATGAAGCGCTTCTGG -3'
(R):5'- GCTGCTGTTATGCTTGATCC -3'

Sequencing Primer
(F):5'- GCGCTTCTGGTTAAAATGATTCAGC -3'
(R):5'- CTATTCTGCTTAGAAGTAGCTGCTGC -3'

Posted On

2019-06-26