Incidental Mutation 'R7315:Ninl'
ID567862
Institutional Source Beutler Lab
Gene Symbol Ninl
Ensembl Gene ENSMUSG00000068115
Gene Nameninein-like
SynonymsLOC381387, LOC381388, 4930519N13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7315 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150934519-151039382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150950050 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 851 (V851A)
Ref Sequence ENSEMBL: ENSMUSP00000105522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109896] [ENSMUST00000124135]
Predicted Effect probably benign
Transcript: ENSMUST00000109896
AA Change: V851A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115
AA Change: V851A

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117833
Predicted Effect probably benign
Transcript: ENSMUST00000124135
SMART Domains Protein: ENSMUSP00000122069
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
coiled coil region 16 61 N/A INTRINSIC
coiled coil region 92 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147293
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone-marrow myeloid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Ninl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ninl APN 2 150966241 missense probably damaging 0.98
IGL01697:Ninl APN 2 150939947 missense probably damaging 1.00
IGL01756:Ninl APN 2 150979516 missense probably damaging 1.00
IGL01925:Ninl APN 2 150971059 missense probably damaging 1.00
IGL02341:Ninl APN 2 150944605 nonsense probably null
IGL02838:Ninl APN 2 150955711 splice site probably null
IGL02868:Ninl APN 2 150937054 missense probably benign
IGL03116:Ninl APN 2 150964219 missense probably damaging 1.00
IGL03396:Ninl APN 2 150966212 missense possibly damaging 0.88
R0117:Ninl UTSW 2 150937673 missense probably damaging 0.98
R0685:Ninl UTSW 2 150939855 missense possibly damaging 0.73
R0928:Ninl UTSW 2 150963475 missense probably damaging 0.99
R1051:Ninl UTSW 2 150970126 missense probably damaging 1.00
R1441:Ninl UTSW 2 150971124 missense probably benign 0.10
R1493:Ninl UTSW 2 150980095 missense probably damaging 1.00
R1499:Ninl UTSW 2 150980176 missense possibly damaging 0.70
R1539:Ninl UTSW 2 150975947 missense probably damaging 1.00
R1658:Ninl UTSW 2 150964159 missense probably damaging 1.00
R2038:Ninl UTSW 2 150975843 nonsense probably null
R2156:Ninl UTSW 2 150944583 missense probably damaging 1.00
R2232:Ninl UTSW 2 150950050 missense probably benign 0.00
R2373:Ninl UTSW 2 150980117 missense probably damaging 1.00
R3743:Ninl UTSW 2 150950248 missense probably benign 0.01
R3906:Ninl UTSW 2 150980119 missense probably damaging 1.00
R3950:Ninl UTSW 2 150952488 missense possibly damaging 0.90
R4283:Ninl UTSW 2 150953416 unclassified probably benign
R4798:Ninl UTSW 2 150959881 nonsense probably null
R4963:Ninl UTSW 2 150939909 missense probably benign 0.04
R4998:Ninl UTSW 2 150953364 missense probably damaging 1.00
R5343:Ninl UTSW 2 150971190 missense probably benign 0.01
R5810:Ninl UTSW 2 150950168 missense probably benign 0.31
R5825:Ninl UTSW 2 150940724 missense probably damaging 1.00
R6436:Ninl UTSW 2 150966178 missense probably damaging 1.00
R6728:Ninl UTSW 2 150975857 nonsense probably null
R6734:Ninl UTSW 2 150945083 critical splice donor site probably null
R6997:Ninl UTSW 2 150966225 missense probably benign 0.08
R7135:Ninl UTSW 2 150955604 missense probably benign 0.00
R7157:Ninl UTSW 2 150949343 missense possibly damaging 0.63
R7840:Ninl UTSW 2 150966096 missense probably benign 0.00
R7923:Ninl UTSW 2 150966096 missense probably benign 0.00
X0062:Ninl UTSW 2 150970046 missense probably damaging 1.00
Z1177:Ninl UTSW 2 150953398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATACTACAGAGCTGGCCAGG -3'
(R):5'- CTCAGCTTGACCTGGAGAAG -3'

Sequencing Primer
(F):5'- GGAAAATCCCTGCCCTCTG -3'
(R):5'- CCTGGAGAAGGGGCGGC -3'
Posted On2019-06-26