Incidental Mutation 'R7315:Fnip2'
ID567864
Institutional Source Beutler Lab
Gene Symbol Fnip2
Ensembl Gene ENSMUSG00000061175
Gene Namefolliculin interacting protein 2
SynonymsD630023B12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7315 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location79455974-79567796 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 79506205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000076136] [ENSMUST00000076136] [ENSMUST00000133154] [ENSMUST00000133154] [ENSMUST00000133154]
Predicted Effect probably null
Transcript: ENSMUST00000076136
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076136
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076136
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133154
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133154
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133154
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Fnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Fnip2 APN 3 79481521 missense probably benign
IGL00339:Fnip2 APN 3 79515155 missense probably benign 0.12
IGL00340:Fnip2 APN 3 79518061 splice site probably benign
IGL00434:Fnip2 APN 3 79512489 splice site probably benign
IGL01134:Fnip2 APN 3 79512503 nonsense probably null
IGL02732:Fnip2 APN 3 79465697 missense probably damaging 1.00
IGL03327:Fnip2 APN 3 79518081 missense probably damaging 0.98
IGL03402:Fnip2 APN 3 79481276 missense possibly damaging 0.92
R0314:Fnip2 UTSW 3 79481189 missense probably damaging 1.00
R0318:Fnip2 UTSW 3 79512378 missense probably damaging 1.00
R0699:Fnip2 UTSW 3 79481139 missense probably benign 0.00
R1188:Fnip2 UTSW 3 79462162 missense probably damaging 1.00
R1290:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1535:Fnip2 UTSW 3 79481765 missense probably damaging 1.00
R1618:Fnip2 UTSW 3 79508168 missense possibly damaging 0.70
R1661:Fnip2 UTSW 3 79515149 missense probably benign
R1665:Fnip2 UTSW 3 79515149 missense probably benign
R1965:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1966:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1976:Fnip2 UTSW 3 79480931 missense probably benign 0.02
R2004:Fnip2 UTSW 3 79512325 splice site probably benign
R2054:Fnip2 UTSW 3 79572465 unclassified probably benign
R2145:Fnip2 UTSW 3 79500432 missense probably damaging 0.99
R2400:Fnip2 UTSW 3 79479634 missense probably benign 0.03
R2679:Fnip2 UTSW 3 79480926 missense probably benign 0.13
R3157:Fnip2 UTSW 3 79567594 missense probably damaging 1.00
R3851:Fnip2 UTSW 3 79462157 missense probably damaging 1.00
R3910:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3911:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3912:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R4035:Fnip2 UTSW 3 79479501 missense probably benign 0.00
R4166:Fnip2 UTSW 3 79462135 missense probably damaging 1.00
R4537:Fnip2 UTSW 3 79465714 missense probably damaging 0.98
R4732:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4733:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4774:Fnip2 UTSW 3 79465721 nonsense probably null
R4923:Fnip2 UTSW 3 79489394 critical splice acceptor site probably null
R5043:Fnip2 UTSW 3 79492867 nonsense probably null
R5160:Fnip2 UTSW 3 79488991 missense probably damaging 1.00
R5162:Fnip2 UTSW 3 79481777 missense probably damaging 1.00
R5196:Fnip2 UTSW 3 79572538 unclassified probably benign
R5283:Fnip2 UTSW 3 79465708 missense probably damaging 1.00
R5364:Fnip2 UTSW 3 79481168 missense probably benign 0.00
R5402:Fnip2 UTSW 3 79480943 missense possibly damaging 0.89
R6340:Fnip2 UTSW 3 79507845 missense probably damaging 1.00
R6459:Fnip2 UTSW 3 79481634 missense possibly damaging 0.93
R6592:Fnip2 UTSW 3 79481708 missense probably benign 0.26
R6616:Fnip2 UTSW 3 79480882 missense probably benign 0.00
R6933:Fnip2 UTSW 3 79518111 missense probably benign 0.28
R6962:Fnip2 UTSW 3 79489303 missense probably damaging 1.00
R6971:Fnip2 UTSW 3 79481121 nonsense probably null
R7050:Fnip2 UTSW 3 79506270 missense probably damaging 0.99
R7097:Fnip2 UTSW 3 79481006 missense probably benign
R7714:Fnip2 UTSW 3 79518114 missense probably damaging 1.00
R7782:Fnip2 UTSW 3 79508123 missense probably benign 0.00
R8381:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGCTGGAAGAAACTTACTAGC -3'
(R):5'- AGCAGTAGCCCACTTTGAAGTC -3'

Sequencing Primer
(F):5'- GCACAATCATTCTGAGATGATGACCG -3'
(R):5'- GCCCACTTTGAAGTCTAGAAATTAC -3'
Posted On2019-06-26