Incidental Mutation 'R7315:Cd1d1'
ID 567865
Institutional Source Beutler Lab
Gene Symbol Cd1d1
Ensembl Gene ENSMUSG00000028076
Gene Name CD1d1 antigen
Synonyms Cd1d, Cd1a, CD1.1, Ly-38
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 86903141-86906748 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86905420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 191 (R191H)
Ref Sequence ENSEMBL: ENSMUSP00000029717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029717
AA Change: R191H

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: R191H

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 1.3e-95 PFAM
IGc1 221 291 5.35e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063869
SMART Domains Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4MQ7|A 23 73 2e-15 PDB
IGc1 90 160 5.35e-22 SMART
low complexity region 173 194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Cd1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Cd1d1 APN 3 86,905,480 (GRCm39) missense probably damaging 0.99
IGL01811:Cd1d1 APN 3 86,903,895 (GRCm39) missense possibly damaging 0.86
IGL02371:Cd1d1 APN 3 86,906,188 (GRCm39) missense probably benign 0.40
IGL03001:Cd1d1 APN 3 86,905,468 (GRCm39) missense probably benign
R0350:Cd1d1 UTSW 3 86,904,880 (GRCm39) missense probably benign 0.11
R1771:Cd1d1 UTSW 3 86,905,972 (GRCm39) missense possibly damaging 0.85
R2407:Cd1d1 UTSW 3 86,905,489 (GRCm39) missense probably damaging 1.00
R3906:Cd1d1 UTSW 3 86,906,063 (GRCm39) missense probably damaging 1.00
R4540:Cd1d1 UTSW 3 86,904,012 (GRCm39) missense probably benign 0.21
R4976:Cd1d1 UTSW 3 86,905,958 (GRCm39) missense probably benign 0.00
R5303:Cd1d1 UTSW 3 86,905,427 (GRCm39) missense probably benign 0.22
R5786:Cd1d1 UTSW 3 86,906,095 (GRCm39) missense probably benign 0.17
R6088:Cd1d1 UTSW 3 86,906,009 (GRCm39) missense probably benign 0.07
R6273:Cd1d1 UTSW 3 86,905,564 (GRCm39) missense probably benign 0.00
R7787:Cd1d1 UTSW 3 86,904,903 (GRCm39) missense probably damaging 0.98
R8854:Cd1d1 UTSW 3 86,905,480 (GRCm39) missense probably damaging 0.99
R8957:Cd1d1 UTSW 3 86,906,140 (GRCm39) missense probably damaging 0.99
R9079:Cd1d1 UTSW 3 86,906,197 (GRCm39) missense probably benign
R9328:Cd1d1 UTSW 3 86,905,459 (GRCm39) missense possibly damaging 0.80
R9368:Cd1d1 UTSW 3 86,905,939 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCCAAGAGTGGCTGTCAG -3'
(R):5'- CTGCGGGCTGTGAAATGTAC -3'

Sequencing Primer
(F):5'- TGGCTGTCAGTGAGAAAATAAACCC -3'
(R):5'- GAAATGTACCCTGGGAATGCTTC -3'
Posted On 2019-06-26