Incidental Mutation 'R7315:Col24a1'
ID 567867
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 145292472-145552011 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 145431870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 896 (S896N)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect possibly damaging
Transcript: ENSMUST00000029848
AA Change: S896N

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: S896N

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145545316 splice site probably benign
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R1969:Col24a1 UTSW 3 145314930 missense probably benign 0.03
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R4972:Col24a1 UTSW 3 145509684 missense probably benign 0.42
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145315025 nonsense probably null
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145486304 nonsense probably null
R7358:Col24a1 UTSW 3 145293165 critical splice donor site probably null
R7371:Col24a1 UTSW 3 145343698 missense probably benign 0.06
R7383:Col24a1 UTSW 3 145298838 missense probably benign
R7605:Col24a1 UTSW 3 145538687 missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145314453 missense probably benign 0.00
R7679:Col24a1 UTSW 3 145399355 missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145315011 missense probably benign
R7701:Col24a1 UTSW 3 145366901 splice site probably null
R7805:Col24a1 UTSW 3 145314140 missense probably benign 0.02
R7913:Col24a1 UTSW 3 145431866 nonsense probably null
R7921:Col24a1 UTSW 3 145474238 missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145314164 missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145507702 missense probably benign 0.31
R8294:Col24a1 UTSW 3 145481089 missense probably null 1.00
R8305:Col24a1 UTSW 3 145474182 missense probably benign 0.00
R8430:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145545265 missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145314037 missense probably null
R9056:Col24a1 UTSW 3 145315248 missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145481124 nonsense probably null
R9612:Col24a1 UTSW 3 145545205 missense probably benign 0.32
R9777:Col24a1 UTSW 3 145315342 nonsense probably null
Z1176:Col24a1 UTSW 3 145342498 missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145342499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGCAGGCATGGGGTTAAAATG -3'
(R):5'- GGCTCATGTATTATTCTCCCCAAAC -3'

Sequencing Primer
(F):5'- ATGCAAGCTCTGTACGTTTCAG -3'
(R):5'- CATGTATTATTCTCCCCAAACTGTAG -3'
Posted On 2019-06-26