Incidental Mutation 'R7315:Opn1sw'
ID 567874
Institutional Source Beutler Lab
Gene Symbol Opn1sw
Ensembl Gene ENSMUSG00000058831
Gene Name opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
Synonyms Blue/UV Opsin, Bcp, UV cone pigment, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 29376670-29380512 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29379362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 214 (I214N)
Ref Sequence ENSEMBL: ENSMUSP00000079289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031779] [ENSMUST00000080428] [ENSMUST00000090481] [ENSMUST00000147483] [ENSMUST00000172974] [ENSMUST00000173216] [ENSMUST00000173653] [ENSMUST00000173694] [ENSMUST00000174096]
AlphaFold P51491
Predicted Effect probably benign
Transcript: ENSMUST00000031779
SMART Domains Protein: ENSMUSP00000031779
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 3e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080428
AA Change: I214N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079289
Gene: ENSMUSG00000058831
AA Change: I214N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 41 318 4e-9 PFAM
Pfam:7tm_1 49 301 2.5e-43 PFAM
Pfam:7tm_4 188 319 6.2e-8 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090481
SMART Domains Protein: ENSMUSP00000087967
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.82e0 SMART
EFh 108 136 2.44e1 SMART
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147483
AA Change: I214N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133745
Gene: ENSMUSG00000058831
AA Change: I214N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 250 9.2e-7 PFAM
Pfam:7TM_GPCR_Srv 41 254 1.8e-6 PFAM
Pfam:7tm_1 49 271 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172607
SMART Domains Protein: ENSMUSP00000133609
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
Blast:EFh 2 20 1e-5 BLAST
SCOP:d2mysb_ 2 51 6e-5 SMART
Blast:EFh 28 56 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172974
SMART Domains Protein: ENSMUSP00000133390
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 1e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 1.41e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173216
SMART Domains Protein: ENSMUSP00000134708
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
EFh 3 31 9.61e1 SMART
EFh 40 68 2.03e-2 SMART
Blast:EFh 81 109 2e-11 BLAST
EFh 117 145 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173653
SMART Domains Protein: ENSMUSP00000133534
Gene: ENSMUSG00000058831

DomainStartEndE-ValueType
Pfam:7tm_1 1 61 6.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173694
SMART Domains Protein: ENSMUSP00000133436
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 5.38e0 SMART
EFh 108 136 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174096
SMART Domains Protein: ENSMUSP00000133945
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EF-hand_7 43 97 5.3e-8 PFAM
Pfam:EF-hand_6 72 101 6.5e-5 PFAM
Pfam:EF-hand_7 72 133 5e-12 PFAM
Pfam:EF-hand_5 73 98 4.5e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family, opsin subfamily. It encodes the blue cone pigment gene which is one of three types of cone photoreceptors responsible for normal color vision. Defects in this gene are the cause of tritan color blindness (tritanopia). Affected individuals lack blue and yellow sensory mechanisms while retaining those for red and green. Defective blue vision is characteristic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal cone physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Opn1sw
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Opn1sw APN 6 29,379,803 (GRCm39) missense possibly damaging 0.88
R0550:Opn1sw UTSW 6 29,380,203 (GRCm39) missense probably damaging 1.00
R1533:Opn1sw UTSW 6 29,378,923 (GRCm39) missense probably benign 0.36
R1902:Opn1sw UTSW 6 29,379,803 (GRCm39) missense possibly damaging 0.88
R4085:Opn1sw UTSW 6 29,380,143 (GRCm39) missense possibly damaging 0.89
R4418:Opn1sw UTSW 6 29,379,423 (GRCm39) nonsense probably null
R4812:Opn1sw UTSW 6 29,378,038 (GRCm39) missense probably damaging 0.99
R5692:Opn1sw UTSW 6 29,379,840 (GRCm39) unclassified probably benign
R5839:Opn1sw UTSW 6 29,379,829 (GRCm39) missense probably damaging 1.00
R5915:Opn1sw UTSW 6 29,379,754 (GRCm39) splice site probably null
R6045:Opn1sw UTSW 6 29,379,869 (GRCm39) missense probably damaging 1.00
R6295:Opn1sw UTSW 6 29,379,413 (GRCm39) missense possibly damaging 0.90
R6784:Opn1sw UTSW 6 29,379,846 (GRCm39) missense probably damaging 1.00
R7259:Opn1sw UTSW 6 29,378,911 (GRCm39) missense probably benign
R7412:Opn1sw UTSW 6 29,379,856 (GRCm39) missense probably damaging 1.00
R7749:Opn1sw UTSW 6 29,380,168 (GRCm39) missense probably benign 0.00
R9383:Opn1sw UTSW 6 29,378,000 (GRCm39) missense possibly damaging 0.95
R9385:Opn1sw UTSW 6 29,379,425 (GRCm39) missense probably damaging 1.00
R9591:Opn1sw UTSW 6 29,378,926 (GRCm39) missense probably damaging 1.00
Z1176:Opn1sw UTSW 6 29,379,455 (GRCm39) missense probably damaging 1.00
Z1177:Opn1sw UTSW 6 29,380,343 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAACAGCGTTTTCACTCCC -3'
(R):5'- ACTGTAGTGTCTTCTGGCATTC -3'

Sequencing Primer
(F):5'- CCCTTCCCCAATACTCCTATCTGAC -3'
(R):5'- CTGGCATTCTTCCAACTGGAGAAG -3'
Posted On 2019-06-26