Incidental Mutation 'R7315:Rassf8'
ID 567877
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene Name Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms 5133400D11Rik, mHoj-1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 145746748-145821079 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145815751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 268 (M268V)
Ref Sequence ENSEMBL: ENSMUSP00000032388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
AlphaFold Q8CJ96
Predicted Effect probably benign
Transcript: ENSMUST00000032388
AA Change: M268V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: M268V

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058538
Predicted Effect probably benign
Transcript: ENSMUST00000111704
AA Change: M268V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: M268V

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7274:Rassf8 UTSW 6 145815569 missense probably benign 0.03
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8222:Rassf8 UTSW 6 145820057 missense unknown
R8374:Rassf8 UTSW 6 145815137 nonsense probably null
R8409:Rassf8 UTSW 6 145815703 missense probably benign
R9314:Rassf8 UTSW 6 145816570 missense probably damaging 1.00
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTACAGCTGTAGCCTGGAG -3'
(R):5'- TAAGATGCCCTTACCTGTAGCC -3'

Sequencing Primer
(F):5'- CCTGGAGGAGGAGATTGTCC -3'
(R):5'- ACCTGTAGCCGCTTGGTG -3'
Posted On 2019-06-26