Incidental Mutation 'R7315:Nav2'
ID 567878
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 48908716-49610090 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49548289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 33 (N33S)
Ref Sequence ENSEMBL: ENSMUSP00000138846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect probably damaging
Transcript: ENSMUST00000064395
AA Change: N1222S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: N1222S

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
AA Change: N1161S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: N1161S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184109
AA Change: N33S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512
AA Change: N33S

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: N1222S

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: N1222S

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 (GRCm38) I1264L probably benign Het
Abcg8 C A 17: 84,696,714 (GRCm38) D484E probably damaging Het
Abhd13 T A 8: 9,987,970 (GRCm38) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acpp A G 9: 104,316,224 (GRCm38) probably null Het
Agpat4 C T 17: 12,210,298 (GRCm38) R146C probably damaging Het
Antxrl T C 14: 34,071,547 (GRCm38) S411P unknown Het
B4galt5 A G 2: 167,301,376 (GRCm38) V376A probably damaging Het
BB287469 A G 12: 87,819,703 (GRCm38) E128G unknown Het
Camk1d T C 2: 5,339,230 (GRCm38) Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 (GRCm38) R191H possibly damaging Het
Cd93 A G 2: 148,442,541 (GRCm38) V295A probably damaging Het
Cdc27 G A 11: 104,515,444 (GRCm38) T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 (GRCm38) Y1221H unknown Het
Col24a1 G A 3: 145,431,870 (GRCm38) S896N possibly damaging Het
Cst7 C A 2: 150,570,583 (GRCm38) P22Q probably benign Het
Dnah6 C T 6: 73,084,760 (GRCm38) A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 (GRCm38) A1588T probably benign Het
Dsg2 A T 18: 20,579,160 (GRCm38) I118F probably damaging Het
Eme2 G A 17: 24,894,866 (GRCm38) R62W probably damaging Het
Epha3 A T 16: 63,552,609 (GRCm38) D910E probably benign Het
Ext1 T C 15: 53,073,387 (GRCm38) D654G probably damaging Het
Fam46b C T 4: 133,487,084 (GRCm38) T422I probably damaging Het
Fnip2 A G 3: 79,506,205 (GRCm38) probably null Het
Gon4l T A 3: 88,895,179 (GRCm38) H1032Q probably benign Het
Ispd A G 12: 36,390,374 (GRCm38) T94A probably benign Het
Kitl G A 10: 100,016,112 (GRCm38) R31H unknown Het
Lcp2 G A 11: 34,069,906 (GRCm38) probably null Het
Lrp2 T C 2: 69,491,822 (GRCm38) H1921R probably damaging Het
Lvrn A G 18: 46,876,984 (GRCm38) T400A probably benign Het
Mak16 G A 8: 31,164,738 (GRCm38) R143* probably null Het
Mettl23 A G 11: 116,849,102 (GRCm38) I159V probably benign Het
Mr1 T C 1: 155,129,290 (GRCm38) N335D probably benign Het
Muc2 T C 7: 141,690,402 (GRCm38) C12R probably damaging Het
Myom1 T C 17: 71,080,897 (GRCm38) probably null Het
Ninl A G 2: 150,950,050 (GRCm38) V851A probably benign Het
Nmt1 A G 11: 103,060,183 (GRCm38) N367D probably benign Het
Noc2l T G 4: 156,241,360 (GRCm38) S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 (GRCm38) C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 (GRCm38) V113A probably damaging Het
Olfr151 T C 9: 37,730,576 (GRCm38) M136V probably benign Het
Olfr198 A G 16: 59,202,133 (GRCm38) F98L probably benign Het
Olfr293 T C 7: 86,664,237 (GRCm38) S192P probably damaging Het
Olfr70 T A 4: 43,696,961 (GRCm38) I71F probably damaging Het
Olfr860 G T 9: 19,845,835 (GRCm38) S261R probably damaging Het
Olfr877 A T 9: 37,855,247 (GRCm38) Y143F probably benign Het
Opn1sw A T 6: 29,379,363 (GRCm38) I214N probably damaging Het
Papss2 T C 19: 32,639,225 (GRCm38) V217A possibly damaging Het
Pes1 A G 11: 3,976,085 (GRCm38) I291M probably benign Het
Pqlc2 G A 4: 139,301,870 (GRCm38) T101M probably damaging Het
Ptprb T A 10: 116,362,379 (GRCm38) I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 (GRCm38) T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 (GRCm38) M268V probably benign Het
Rbl2 A T 8: 91,076,012 (GRCm38) T154S probably damaging Het
Rgs1 A G 1: 144,248,899 (GRCm38) probably null Het
Rpgrip1 C T 14: 52,121,001 (GRCm38) T188I not run Het
Rrp1b T A 17: 32,058,571 (GRCm38) F608L probably benign Het
Sbp C T 17: 23,945,306 (GRCm38) A154V probably benign Het
Scara3 C T 14: 65,931,440 (GRCm38) E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 (GRCm38) D110V probably benign Het
Skiv2l T A 17: 34,841,169 (GRCm38) D875V probably benign Het
Slc2a4 G C 11: 69,946,433 (GRCm38) T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 (GRCm38) S462P probably damaging Het
Snx33 C T 9: 56,925,867 (GRCm38) R306H probably damaging Het
Srf T C 17: 46,551,794 (GRCm38) probably null Het
Steap3 A G 1: 120,227,912 (GRCm38) V439A probably benign Het
Syt10 C T 15: 89,814,338 (GRCm38) D268N probably damaging Het
Terf2 T C 8: 107,081,217 (GRCm38) N242S probably benign Het
Tex15 A G 8: 33,581,516 (GRCm38) T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 (GRCm38) H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 (GRCm38) N837K probably benign Het
Trim67 T A 8: 124,794,330 (GRCm38) S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 (GRCm38) D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 (GRCm38) V1184E probably benign Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,571,194 (GRCm38) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,452,521 (GRCm38) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,575,729 (GRCm38) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,571,209 (GRCm38) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,594,229 (GRCm38) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,558,773 (GRCm38) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,452,512 (GRCm38) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,546,041 (GRCm38) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,582,875 (GRCm38) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,565,095 (GRCm38) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,420,256 (GRCm38) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,548,423 (GRCm38) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,464,879 (GRCm38) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,462,008 (GRCm38) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,362,099 (GRCm38) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,491,457 (GRCm38) nonsense probably null
R0006:Nav2 UTSW 7 49,453,230 (GRCm38) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,570,714 (GRCm38) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,535,953 (GRCm38) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,545,903 (GRCm38) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,604,585 (GRCm38) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,461,938 (GRCm38) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,408,683 (GRCm38) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,420,333 (GRCm38) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,584,153 (GRCm38) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,536,040 (GRCm38) splice site probably benign
R1274:Nav2 UTSW 7 49,604,430 (GRCm38) nonsense probably null
R1463:Nav2 UTSW 7 49,535,962 (GRCm38) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,362,204 (GRCm38) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,362,204 (GRCm38) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,545,934 (GRCm38) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,571,211 (GRCm38) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,452,465 (GRCm38) missense probably benign
R1731:Nav2 UTSW 7 49,548,174 (GRCm38) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,575,720 (GRCm38) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,548,195 (GRCm38) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,464,872 (GRCm38) missense probably damaging 1.00
R1997:Nav2 UTSW 7 49,548,471 (GRCm38) missense probably benign 0.16
R2061:Nav2 UTSW 7 49,598,897 (GRCm38) splice site probably benign
R2117:Nav2 UTSW 7 49,464,580 (GRCm38) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,452,663 (GRCm38) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,597,254 (GRCm38) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,453,277 (GRCm38) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,491,404 (GRCm38) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,598,817 (GRCm38) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,408,884 (GRCm38) missense probably benign
R2568:Nav2 UTSW 7 49,597,564 (GRCm38) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,545,942 (GRCm38) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,557,032 (GRCm38) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,557,032 (GRCm38) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,464,562 (GRCm38) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,545,858 (GRCm38) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,597,231 (GRCm38) missense probably damaging 1.00
R4207:Nav2 UTSW 7 49,572,298 (GRCm38) splice site probably null
R4411:Nav2 UTSW 7 49,398,109 (GRCm38) missense probably benign 0.37
R4413:Nav2 UTSW 7 49,398,109 (GRCm38) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,575,263 (GRCm38) splice site probably benign
R4440:Nav2 UTSW 7 49,552,037 (GRCm38) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,548,544 (GRCm38) splice site probably null
R4729:Nav2 UTSW 7 49,452,819 (GRCm38) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,545,852 (GRCm38) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,545,852 (GRCm38) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,409,001 (GRCm38) intron probably benign
R4887:Nav2 UTSW 7 49,548,434 (GRCm38) nonsense probably null
R4908:Nav2 UTSW 7 49,604,510 (GRCm38) missense probably damaging 1.00
R4952:Nav2 UTSW 7 49,304,540 (GRCm38) intron probably benign
R4965:Nav2 UTSW 7 49,552,877 (GRCm38) nonsense probably null
R5169:Nav2 UTSW 7 49,548,483 (GRCm38) nonsense probably null
R5224:Nav2 UTSW 7 49,551,725 (GRCm38) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,535,913 (GRCm38) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,548,234 (GRCm38) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,408,692 (GRCm38) small deletion probably benign
R5320:Nav2 UTSW 7 49,491,373 (GRCm38) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,589,160 (GRCm38) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,548,169 (GRCm38) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,557,046 (GRCm38) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,548,069 (GRCm38) splice site probably null
R5884:Nav2 UTSW 7 49,597,169 (GRCm38) nonsense probably null
R5921:Nav2 UTSW 7 49,304,576 (GRCm38) intron probably benign
R6180:Nav2 UTSW 7 49,458,167 (GRCm38) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,564,103 (GRCm38) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,453,175 (GRCm38) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,594,366 (GRCm38) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,597,533 (GRCm38) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,594,352 (GRCm38) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,464,904 (GRCm38) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,551,916 (GRCm38) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,458,169 (GRCm38) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,491,456 (GRCm38) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,420,328 (GRCm38) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,461,924 (GRCm38) missense possibly damaging 0.55
R7337:Nav2 UTSW 7 49,551,773 (GRCm38) missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49,554,203 (GRCm38) splice site probably null
R7451:Nav2 UTSW 7 49,552,829 (GRCm38) splice site probably null
R7545:Nav2 UTSW 7 49,582,857 (GRCm38) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,594,319 (GRCm38) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,572,397 (GRCm38) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,597,173 (GRCm38) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,587,777 (GRCm38) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,551,950 (GRCm38) nonsense probably null
R8119:Nav2 UTSW 7 49,453,484 (GRCm38) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,554,261 (GRCm38) critical splice donor site probably null
R8306:Nav2 UTSW 7 49,546,017 (GRCm38) missense probably benign 0.33
R8331:Nav2 UTSW 7 49,452,623 (GRCm38) missense probably benign
R8402:Nav2 UTSW 7 49,453,437 (GRCm38) missense probably benign 0.43
R8421:Nav2 UTSW 7 49,452,521 (GRCm38) missense probably benign
R8478:Nav2 UTSW 7 49,461,985 (GRCm38) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,491,436 (GRCm38) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,452,572 (GRCm38) missense probably benign
R8835:Nav2 UTSW 7 49,598,803 (GRCm38) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,461,957 (GRCm38) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,571,216 (GRCm38) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,558,813 (GRCm38) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,604,545 (GRCm38) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,552,851 (GRCm38) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,597,156 (GRCm38) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,547,899 (GRCm38) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,594,223 (GRCm38) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,452,761 (GRCm38) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGGTAAAATCCCCAAGTCGTCC -3'
(R):5'- TCTGCATACTTGGTCCCTGG -3'

Sequencing Primer
(F):5'- AAGTCGTCCGCCCTCGTC -3'
(R):5'- ATACTTGGTCCCTGGCTGCAG -3'
Posted On 2019-06-26