Mutagenetix > Incidental Mutations

Incidental Mutation 'R7315:Nav2'

567878

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.542) question?

Stock #

R7315 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49548289 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 33 (N33S)

Ref Sequence

ENSEMBL: ENSMUSP00000138846 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064395
AA Change: N1222S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: N1222S

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183659
AA Change: N1161S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: N1161S

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000184109
AA Change: N33S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512
AA Change: N33S

Domain	Start	End	E-Value	Type
low complexity region	154	171	N/A	INTRINSIC
low complexity region	179	196	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184945
AA Change: N1222S

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: N1222S

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	C	7: 120,294,118	I1264L	probably benign	Het
Abcg8	C	A	17: 84,696,714	D484E	probably damaging	Het
Abhd13	T	A	8: 9,987,970	L189H	probably damaging	Het
Acox2	T	C	14: 8,256,139	D60G	probably damaging	Het
Acpp	A	G	9: 104,316,224		probably null	Het
Agpat4	C	T	17: 12,210,298	R146C	probably damaging	Het
Antxrl	T	C	14: 34,071,547	S411P	unknown	Het
B4galt5	A	G	2: 167,301,376	V376A	probably damaging	Het
BB287469	A	G	12: 87,819,703	E128G	unknown	Het
Camk1d	T	C	2: 5,339,230	Y198C	probably damaging	Het
Cd1d1	C	T	3: 86,998,113	R191H	possibly damaging	Het
Cd93	A	G	2: 148,442,541	V295A	probably damaging	Het
Cdc27	G	A	11: 104,515,444	T615I	possibly damaging	Het
Cfap74	T	C	4: 155,463,019	Y1221H	unknown	Het
Col24a1	G	A	3: 145,431,870	S896N	possibly damaging	Het
Cst7	C	A	2: 150,570,583	P22Q	probably benign	Het
Dnah6	C	T	6: 73,084,760	A2781T	probably damaging	Het
Dscaml1	G	A	9: 45,745,125	A1588T	probably benign	Het
Dsg2	A	T	18: 20,579,160	I118F	probably damaging	Het
Eme2	G	A	17: 24,894,866	R62W	probably damaging	Het
Epha3	A	T	16: 63,552,609	D910E	probably benign	Het
Ext1	T	C	15: 53,073,387	D654G	probably damaging	Het
Fam46b	C	T	4: 133,487,084	T422I	probably damaging	Het
Fnip2	A	G	3: 79,506,205		probably null	Het
Gon4l	T	A	3: 88,895,179	H1032Q	probably benign	Het
Ispd	A	G	12: 36,390,374	T94A	probably benign	Het
Kitl	G	A	10: 100,016,112	R31H	unknown	Het
Lcp2	G	A	11: 34,069,906		probably null	Het
Lrp2	T	C	2: 69,491,822	H1921R	probably damaging	Het
Lvrn	A	G	18: 46,876,984	T400A	probably benign	Het
Mak16	G	A	8: 31,164,738	R143*	probably null	Het
Mettl23	A	G	11: 116,849,102	I159V	probably benign	Het
Mr1	T	C	1: 155,129,290	N335D	probably benign	Het
Muc2	T	C	7: 141,690,402	C12R	probably damaging	Het
Myom1	T	C	17: 71,080,897		probably null	Het
Ninl	A	G	2: 150,950,050	V851A	probably benign	Het
Nmt1	A	G	11: 103,060,183	N367D	probably benign	Het
Noc2l	T	G	4: 156,241,360	S354R	probably damaging	Het
Olfr104-ps	G	T	17: 37,362,660	C181F	probably damaging	Het
Olfr1302	T	C	2: 111,780,659	V113A	probably damaging	Het
Olfr151	T	C	9: 37,730,576	M136V	probably benign	Het
Olfr198	A	G	16: 59,202,133	F98L	probably benign	Het
Olfr293	T	C	7: 86,664,237	S192P	probably damaging	Het
Olfr70	T	A	4: 43,696,961	I71F	probably damaging	Het
Olfr860	G	T	9: 19,845,835	S261R	probably damaging	Het
Olfr877	A	T	9: 37,855,247	Y143F	probably benign	Het
Opn1sw	A	T	6: 29,379,363	I214N	probably damaging	Het
Papss2	T	C	19: 32,639,225	V217A	possibly damaging	Het
Pes1	A	G	11: 3,976,085	I291M	probably benign	Het
Pqlc2	G	A	4: 139,301,870	T101M	probably damaging	Het
Ptprb	T	A	10: 116,362,379	I1660N	possibly damaging	Het
Rapgef1	C	A	2: 29,734,492	T1030K	probably damaging	Het
Rassf8	A	G	6: 145,815,751	M268V	probably benign	Het
Rbl2	A	T	8: 91,076,012	T154S	probably damaging	Het
Rgs1	A	G	1: 144,248,899		probably null	Het
Rpgrip1	C	T	14: 52,121,001	T188I	not run	Het
Rrp1b	T	A	17: 32,058,571	F608L	probably benign	Het
Sbp	C	T	17: 23,945,306	A154V	probably benign	Het
Scara3	C	T	14: 65,931,440	E243K	probably damaging	Het
Serpinb6b	A	T	13: 32,972,257	D110V	probably benign	Het
Skiv2l	T	A	17: 34,841,169	D875V	probably benign	Het
Slc2a4	G	C	11: 69,946,433	T59R	probably damaging	Het
Slc4a1	A	G	11: 102,356,484	S462P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Srf	T	C	17: 46,551,794		probably null	Het
Steap3	A	G	1: 120,227,912	V439A	probably benign	Het
Syt10	C	T	15: 89,814,338	D268N	probably damaging	Het
Terf2	T	C	8: 107,081,217	N242S	probably benign	Het
Tex15	A	G	8: 33,581,516	T2364A	probably benign	Het
Tgfbr2	A	T	9: 116,109,738	H365Q	possibly damaging	Het
Tnrc6c	T	G	11: 117,723,528	N837K	probably benign	Het
Trim67	T	A	8: 124,794,330	S144T	probably benign	Het
Zc3hav1l	T	G	6: 38,295,147	D229A	possibly damaging	Het
Zmym4	A	T	4: 126,882,592	V1184E	probably benign	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	unclassified	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGGTAAAATCCCCAAGTCGTCC -3'
(R):5'- TCTGCATACTTGGTCCCTGG -3'

Sequencing Primer
(F):5'- AAGTCGTCCGCCCTCGTC -3'
(R):5'- ATACTTGGTCCCTGGCTGCAG -3'

Posted On

2019-06-26