Incidental Mutation 'R7315:Abca14'
ID 567880
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 119893341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1264 (I1264L)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: I1264L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: I1264L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGAAGTGCATTTCTCTTAGTC -3'
(R):5'- CTGTAAGGCCTGTACTCTGC -3'

Sequencing Primer
(F):5'- ATCAATATGGATTTTCCTTCGAACCC -3'
(R):5'- GTAAGGCCTGTACTCTGCTACTTAC -3'
Posted On 2019-06-26