Mutagenetix > Incidental Mutation

Incidental Mutation 'R7315:Muc2'

567881

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7315 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141690402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 12 (C12R)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000185406]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: C12R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: C12R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	C	7: 120,294,118	I1264L	probably benign	Het
Abcg8	C	A	17: 84,696,714	D484E	probably damaging	Het
Abhd13	T	A	8: 9,987,970	L189H	probably damaging	Het
Acox2	T	C	14: 8,256,139	D60G	probably damaging	Het
Acpp	A	G	9: 104,316,224		probably null	Het
Agpat4	C	T	17: 12,210,298	R146C	probably damaging	Het
Antxrl	T	C	14: 34,071,547	S411P	unknown	Het
B4galt5	A	G	2: 167,301,376	V376A	probably damaging	Het
BB287469	A	G	12: 87,819,703	E128G	unknown	Het
Camk1d	T	C	2: 5,339,230	Y198C	probably damaging	Het
Cd1d1	C	T	3: 86,998,113	R191H	possibly damaging	Het
Cd93	A	G	2: 148,442,541	V295A	probably damaging	Het
Cdc27	G	A	11: 104,515,444	T615I	possibly damaging	Het
Cfap74	T	C	4: 155,463,019	Y1221H	unknown	Het
Col24a1	G	A	3: 145,431,870	S896N	possibly damaging	Het
Cst7	C	A	2: 150,570,583	P22Q	probably benign	Het
Dnah6	C	T	6: 73,084,760	A2781T	probably damaging	Het
Dscaml1	G	A	9: 45,745,125	A1588T	probably benign	Het
Dsg2	A	T	18: 20,579,160	I118F	probably damaging	Het
Eme2	G	A	17: 24,894,866	R62W	probably damaging	Het
Epha3	A	T	16: 63,552,609	D910E	probably benign	Het
Ext1	T	C	15: 53,073,387	D654G	probably damaging	Het
Fam46b	C	T	4: 133,487,084	T422I	probably damaging	Het
Fnip2	A	G	3: 79,506,205		probably null	Het
Gon4l	T	A	3: 88,895,179	H1032Q	probably benign	Het
Ispd	A	G	12: 36,390,374	T94A	probably benign	Het
Kitl	G	A	10: 100,016,112	R31H	unknown	Het
Lcp2	G	A	11: 34,069,906		probably null	Het
Lrp2	T	C	2: 69,491,822	H1921R	probably damaging	Het
Lvrn	A	G	18: 46,876,984	T400A	probably benign	Het
Mak16	G	A	8: 31,164,738	R143*	probably null	Het
Mettl23	A	G	11: 116,849,102	I159V	probably benign	Het
Mr1	T	C	1: 155,129,290	N335D	probably benign	Het
Myom1	T	C	17: 71,080,897		probably null	Het
Nav2	A	G	7: 49,548,289	N33S	possibly damaging	Het
Ninl	A	G	2: 150,950,050	V851A	probably benign	Het
Nmt1	A	G	11: 103,060,183	N367D	probably benign	Het
Noc2l	T	G	4: 156,241,360	S354R	probably damaging	Het
Olfr104-ps	G	T	17: 37,362,660	C181F	probably damaging	Het
Olfr1302	T	C	2: 111,780,659	V113A	probably damaging	Het
Olfr151	T	C	9: 37,730,576	M136V	probably benign	Het
Olfr198	A	G	16: 59,202,133	F98L	probably benign	Het
Olfr293	T	C	7: 86,664,237	S192P	probably damaging	Het
Olfr70	T	A	4: 43,696,961	I71F	probably damaging	Het
Olfr860	G	T	9: 19,845,835	S261R	probably damaging	Het
Olfr877	A	T	9: 37,855,247	Y143F	probably benign	Het
Opn1sw	A	T	6: 29,379,363	I214N	probably damaging	Het
Papss2	T	C	19: 32,639,225	V217A	possibly damaging	Het
Pes1	A	G	11: 3,976,085	I291M	probably benign	Het
Pqlc2	G	A	4: 139,301,870	T101M	probably damaging	Het
Ptprb	T	A	10: 116,362,379	I1660N	possibly damaging	Het
Rapgef1	C	A	2: 29,734,492	T1030K	probably damaging	Het
Rassf8	A	G	6: 145,815,751	M268V	probably benign	Het
Rbl2	A	T	8: 91,076,012	T154S	probably damaging	Het
Rgs1	A	G	1: 144,248,899		probably null	Het
Rpgrip1	C	T	14: 52,121,001	T188I	not run	Het
Rrp1b	T	A	17: 32,058,571	F608L	probably benign	Het
Sbp	C	T	17: 23,945,306	A154V	probably benign	Het
Scara3	C	T	14: 65,931,440	E243K	probably damaging	Het
Serpinb6b	A	T	13: 32,972,257	D110V	probably benign	Het
Skiv2l	T	A	17: 34,841,169	D875V	probably benign	Het
Slc2a4	G	C	11: 69,946,433	T59R	probably damaging	Het
Slc4a1	A	G	11: 102,356,484	S462P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Srf	T	C	17: 46,551,794		probably null	Het
Steap3	A	G	1: 120,227,912	V439A	probably benign	Het
Syt10	C	T	15: 89,814,338	D268N	probably damaging	Het
Terf2	T	C	8: 107,081,217	N242S	probably benign	Het
Tex15	A	G	8: 33,581,516	T2364A	probably benign	Het
Tgfbr2	A	T	9: 116,109,738	H365Q	possibly damaging	Het
Tnrc6c	T	G	11: 117,723,528	N837K	probably benign	Het
Trim67	T	A	8: 124,794,330	S144T	probably benign	Het
Zc3hav1l	T	G	6: 38,295,147	D229A	possibly damaging	Het
Zmym4	A	T	4: 126,882,592	V1184E	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- ATATTTCCTCTCTGGGACCCATGG -3'
(R):5'- TTTCAACCGCAGAGTGGTGG -3'

Sequencing Primer
(F):5'- GAGCCCCCACAGCTGTTTTC -3'
(R):5'- TGGTAAGAGCCTTAAGACCAGTCC -3'

Posted On

2019-06-26