Incidental Mutation 'R7315:Tex15'
ID 567884
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Name testis expressed gene 15
Synonyms 2210014E14Rik
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 34006766-34075610 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34071544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2364 (T2364A)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124501]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000009772
AA Change: T2364A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: T2364A

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 34,065,339 (GRCm39) missense probably benign 0.18
IGL00705:Tex15 APN 8 34,071,620 (GRCm39) missense probably damaging 1.00
IGL00820:Tex15 APN 8 34,069,034 (GRCm39) splice site probably benign
IGL01288:Tex15 APN 8 34,061,412 (GRCm39) missense probably benign 0.02
IGL01328:Tex15 APN 8 34,061,424 (GRCm39) nonsense probably null
IGL01359:Tex15 APN 8 34,071,926 (GRCm39) missense probably damaging 0.99
IGL01603:Tex15 APN 8 34,063,575 (GRCm39) missense possibly damaging 0.93
IGL01861:Tex15 APN 8 34,060,717 (GRCm39) missense probably damaging 1.00
IGL02052:Tex15 APN 8 34,072,493 (GRCm39) missense probably benign 0.28
IGL02560:Tex15 APN 8 34,071,779 (GRCm39) missense probably benign 0.00
IGL02677:Tex15 APN 8 34,061,108 (GRCm39) missense probably benign 0.03
IGL02739:Tex15 APN 8 34,071,721 (GRCm39) missense possibly damaging 0.68
Big_gulp UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
P0005:Tex15 UTSW 8 34,060,896 (GRCm39) missense probably benign 0.00
P0037:Tex15 UTSW 8 34,071,608 (GRCm39) missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 34,061,129 (GRCm39) missense probably damaging 1.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0595:Tex15 UTSW 8 34,062,645 (GRCm39) missense probably damaging 1.00
R0646:Tex15 UTSW 8 34,072,354 (GRCm39) missense possibly damaging 0.83
R0688:Tex15 UTSW 8 34,063,528 (GRCm39) missense probably damaging 1.00
R0842:Tex15 UTSW 8 34,061,575 (GRCm39) missense possibly damaging 0.95
R0987:Tex15 UTSW 8 34,066,875 (GRCm39) missense probably damaging 1.00
R1084:Tex15 UTSW 8 34,067,032 (GRCm39) missense probably benign 0.28
R1183:Tex15 UTSW 8 34,064,893 (GRCm39) missense probably benign 0.35
R1186:Tex15 UTSW 8 34,061,661 (GRCm39) missense probably benign 0.19
R1378:Tex15 UTSW 8 34,065,244 (GRCm39) missense probably damaging 0.99
R1500:Tex15 UTSW 8 34,065,120 (GRCm39) missense probably damaging 0.96
R1508:Tex15 UTSW 8 34,066,880 (GRCm39) missense probably damaging 1.00
R1597:Tex15 UTSW 8 34,061,511 (GRCm39) missense probably damaging 0.96
R1636:Tex15 UTSW 8 34,066,415 (GRCm39) nonsense probably null
R1639:Tex15 UTSW 8 34,060,845 (GRCm39) missense possibly damaging 0.94
R1809:Tex15 UTSW 8 34,064,262 (GRCm39) missense probably benign
R1843:Tex15 UTSW 8 34,066,682 (GRCm39) missense probably benign 0.27
R2029:Tex15 UTSW 8 34,061,302 (GRCm39) missense probably damaging 0.99
R2228:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2229:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2245:Tex15 UTSW 8 34,061,524 (GRCm39) missense possibly damaging 0.77
R2246:Tex15 UTSW 8 34,072,540 (GRCm39) missense possibly damaging 0.49
R2880:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2881:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2882:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R3001:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3002:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3020:Tex15 UTSW 8 34,066,698 (GRCm39) missense probably damaging 1.00
R3084:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3085:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3701:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3702:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3752:Tex15 UTSW 8 34,061,443 (GRCm39) missense probably benign
R4162:Tex15 UTSW 8 34,071,586 (GRCm39) missense probably damaging 1.00
R4231:Tex15 UTSW 8 34,062,165 (GRCm39) missense probably damaging 0.99
R4589:Tex15 UTSW 8 34,047,401 (GRCm39) missense probably damaging 1.00
R4707:Tex15 UTSW 8 34,072,525 (GRCm39) missense probably benign 0.00
R4773:Tex15 UTSW 8 34,072,760 (GRCm39) missense probably benign 0.42
R4967:Tex15 UTSW 8 34,064,498 (GRCm39) missense probably benign 0.34
R5063:Tex15 UTSW 8 34,072,638 (GRCm39) missense possibly damaging 0.59
R5121:Tex15 UTSW 8 34,061,794 (GRCm39) missense probably damaging 1.00
R5147:Tex15 UTSW 8 34,062,340 (GRCm39) nonsense probably null
R5166:Tex15 UTSW 8 34,066,420 (GRCm39) missense probably benign 0.07
R5173:Tex15 UTSW 8 34,061,768 (GRCm39) missense possibly damaging 0.73
R5439:Tex15 UTSW 8 34,064,199 (GRCm39) missense possibly damaging 0.93
R5537:Tex15 UTSW 8 34,061,641 (GRCm39) missense probably damaging 1.00
R5580:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R5588:Tex15 UTSW 8 34,067,215 (GRCm39) missense probably damaging 1.00
R5696:Tex15 UTSW 8 34,063,220 (GRCm39) missense probably benign 0.01
R5734:Tex15 UTSW 8 34,036,364 (GRCm39) missense probably benign 0.01
R5756:Tex15 UTSW 8 34,065,861 (GRCm39) missense probably benign 0.17
R5823:Tex15 UTSW 8 34,060,962 (GRCm39) missense possibly damaging 0.67
R6126:Tex15 UTSW 8 34,063,591 (GRCm39) missense probably benign 0.19
R6129:Tex15 UTSW 8 34,064,158 (GRCm39) missense possibly damaging 0.90
R6276:Tex15 UTSW 8 34,067,217 (GRCm39) missense possibly damaging 0.93
R6374:Tex15 UTSW 8 34,065,940 (GRCm39) missense probably damaging 1.00
R6430:Tex15 UTSW 8 34,061,329 (GRCm39) missense probably benign 0.01
R6452:Tex15 UTSW 8 34,062,844 (GRCm39) missense probably damaging 1.00
R6471:Tex15 UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
R6700:Tex15 UTSW 8 34,064,917 (GRCm39) missense possibly damaging 0.93
R6918:Tex15 UTSW 8 34,063,212 (GRCm39) missense probably benign 0.27
R6958:Tex15 UTSW 8 34,060,899 (GRCm39) missense probably benign 0.01
R6970:Tex15 UTSW 8 34,047,456 (GRCm39) missense probably benign 0.03
R7059:Tex15 UTSW 8 34,064,758 (GRCm39) missense possibly damaging 0.57
R7069:Tex15 UTSW 8 34,060,748 (GRCm39) missense probably benign
R7072:Tex15 UTSW 8 34,065,459 (GRCm39) missense possibly damaging 0.85
R7212:Tex15 UTSW 8 34,063,023 (GRCm39) missense probably damaging 1.00
R7212:Tex15 UTSW 8 34,060,854 (GRCm39) nonsense probably null
R7216:Tex15 UTSW 8 34,063,014 (GRCm39) missense possibly damaging 0.93
R7219:Tex15 UTSW 8 34,036,268 (GRCm39) missense probably benign 0.40
R7313:Tex15 UTSW 8 34,064,845 (GRCm39) missense possibly damaging 0.82
R7444:Tex15 UTSW 8 34,066,590 (GRCm39) missense possibly damaging 0.92
R7455:Tex15 UTSW 8 34,067,025 (GRCm39) missense possibly damaging 0.91
R7643:Tex15 UTSW 8 34,065,148 (GRCm39) missense probably damaging 1.00
R7644:Tex15 UTSW 8 34,064,445 (GRCm39) missense probably benign 0.01
R7724:Tex15 UTSW 8 34,036,291 (GRCm39) missense possibly damaging 0.60
R7779:Tex15 UTSW 8 34,065,309 (GRCm39) missense probably damaging 1.00
R7798:Tex15 UTSW 8 34,071,875 (GRCm39) missense possibly damaging 0.69
R7816:Tex15 UTSW 8 34,071,683 (GRCm39) missense probably benign 0.14
R7820:Tex15 UTSW 8 34,065,090 (GRCm39) missense probably damaging 0.98
R8041:Tex15 UTSW 8 34,065,874 (GRCm39) missense probably damaging 1.00
R8150:Tex15 UTSW 8 34,063,534 (GRCm39) missense probably benign 0.06
R8152:Tex15 UTSW 8 34,062,921 (GRCm39) missense possibly damaging 0.82
R8237:Tex15 UTSW 8 34,067,427 (GRCm39) missense possibly damaging 0.72
R8250:Tex15 UTSW 8 34,055,233 (GRCm39) missense probably null 0.27
R8264:Tex15 UTSW 8 34,072,390 (GRCm39) missense probably benign 0.18
R8279:Tex15 UTSW 8 34,061,765 (GRCm39) missense probably damaging 0.96
R8353:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8388:Tex15 UTSW 8 34,065,237 (GRCm39) missense probably benign 0.00
R8432:Tex15 UTSW 8 34,066,572 (GRCm39) missense probably damaging 0.99
R8453:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8489:Tex15 UTSW 8 34,067,574 (GRCm39) missense probably benign 0.02
R8670:Tex15 UTSW 8 34,064,746 (GRCm39) missense probably benign 0.19
R8703:Tex15 UTSW 8 34,062,724 (GRCm39) missense probably benign 0.00
R8871:Tex15 UTSW 8 34,066,992 (GRCm39) missense possibly damaging 0.62
R8945:Tex15 UTSW 8 34,064,724 (GRCm39) missense probably benign 0.00
R9104:Tex15 UTSW 8 34,060,950 (GRCm39) missense possibly damaging 0.86
R9132:Tex15 UTSW 8 34,067,554 (GRCm39) missense possibly damaging 0.84
R9207:Tex15 UTSW 8 34,065,784 (GRCm39) missense probably damaging 1.00
R9210:Tex15 UTSW 8 34,064,319 (GRCm39) missense possibly damaging 0.91
R9330:Tex15 UTSW 8 34,065,143 (GRCm39) missense probably benign 0.01
R9354:Tex15 UTSW 8 34,063,344 (GRCm39) missense possibly damaging 0.86
R9365:Tex15 UTSW 8 34,064,564 (GRCm39) missense possibly damaging 0.56
R9440:Tex15 UTSW 8 34,072,273 (GRCm39) missense possibly damaging 0.90
R9534:Tex15 UTSW 8 34,060,999 (GRCm39) missense probably benign 0.45
R9570:Tex15 UTSW 8 34,067,309 (GRCm39) missense probably damaging 0.96
R9574:Tex15 UTSW 8 34,064,509 (GRCm39) missense probably benign 0.09
R9618:Tex15 UTSW 8 34,062,397 (GRCm39) missense probably benign 0.35
R9655:Tex15 UTSW 8 34,066,784 (GRCm39) nonsense probably null
R9786:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R9798:Tex15 UTSW 8 34,062,721 (GRCm39) missense probably damaging 0.98
RF005:Tex15 UTSW 8 34,066,705 (GRCm39) missense probably benign 0.05
X0020:Tex15 UTSW 8 34,066,607 (GRCm39) missense probably benign 0.03
X0065:Tex15 UTSW 8 34,065,545 (GRCm39) nonsense probably null
Z1088:Tex15 UTSW 8 34,061,343 (GRCm39) missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 34,064,898 (GRCm39) missense probably benign
Z1088:Tex15 UTSW 8 34,061,838 (GRCm39) missense possibly damaging 0.68
Z1176:Tex15 UTSW 8 34,064,754 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAGCCTTCTAACAGTATCAGAAG -3'
(R):5'- AAGCTGTCTGTTGGCTCTAC -3'

Sequencing Primer
(F):5'- CATCTTCATCAAGAACCATATCT -3'
(R):5'- GGCTCTACTTTGCTTTCTGACTTTGG -3'
Posted On 2019-06-26