Mutagenetix > Incidental Mutation

Incidental Mutation 'R7315:Tex15'

567884

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Essential gene?

Possibly non essential (E-score: 0.285) question?

Stock #

R7315 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33581516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2364 (T2364A)

Ref Sequence

ENSEMBL: ENSMUSP00000009772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000009772
AA Change: T2364A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: T2364A

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	C	7: 120,294,118	I1264L	probably benign	Het
Abcg8	C	A	17: 84,696,714	D484E	probably damaging	Het
Abhd13	T	A	8: 9,987,970	L189H	probably damaging	Het
Acox2	T	C	14: 8,256,139	D60G	probably damaging	Het
Acpp	A	G	9: 104,316,224		probably null	Het
Agpat4	C	T	17: 12,210,298	R146C	probably damaging	Het
Antxrl	T	C	14: 34,071,547	S411P	unknown	Het
B4galt5	A	G	2: 167,301,376	V376A	probably damaging	Het
BB287469	A	G	12: 87,819,703	E128G	unknown	Het
Camk1d	T	C	2: 5,339,230	Y198C	probably damaging	Het
Cd1d1	C	T	3: 86,998,113	R191H	possibly damaging	Het
Cd93	A	G	2: 148,442,541	V295A	probably damaging	Het
Cdc27	G	A	11: 104,515,444	T615I	possibly damaging	Het
Cfap74	T	C	4: 155,463,019	Y1221H	unknown	Het
Col24a1	G	A	3: 145,431,870	S896N	possibly damaging	Het
Cst7	C	A	2: 150,570,583	P22Q	probably benign	Het
Dnah6	C	T	6: 73,084,760	A2781T	probably damaging	Het
Dscaml1	G	A	9: 45,745,125	A1588T	probably benign	Het
Dsg2	A	T	18: 20,579,160	I118F	probably damaging	Het
Eme2	G	A	17: 24,894,866	R62W	probably damaging	Het
Epha3	A	T	16: 63,552,609	D910E	probably benign	Het
Ext1	T	C	15: 53,073,387	D654G	probably damaging	Het
Fam46b	C	T	4: 133,487,084	T422I	probably damaging	Het
Fnip2	A	G	3: 79,506,205		probably null	Het
Gon4l	T	A	3: 88,895,179	H1032Q	probably benign	Het
Ispd	A	G	12: 36,390,374	T94A	probably benign	Het
Kitl	G	A	10: 100,016,112	R31H	unknown	Het
Lcp2	G	A	11: 34,069,906		probably null	Het
Lrp2	T	C	2: 69,491,822	H1921R	probably damaging	Het
Lvrn	A	G	18: 46,876,984	T400A	probably benign	Het
Mak16	G	A	8: 31,164,738	R143*	probably null	Het
Mettl23	A	G	11: 116,849,102	I159V	probably benign	Het
Mr1	T	C	1: 155,129,290	N335D	probably benign	Het
Muc2	T	C	7: 141,690,402	C12R	probably damaging	Het
Myom1	T	C	17: 71,080,897		probably null	Het
Nav2	A	G	7: 49,548,289	N33S	possibly damaging	Het
Ninl	A	G	2: 150,950,050	V851A	probably benign	Het
Nmt1	A	G	11: 103,060,183	N367D	probably benign	Het
Noc2l	T	G	4: 156,241,360	S354R	probably damaging	Het
Olfr104-ps	G	T	17: 37,362,660	C181F	probably damaging	Het
Olfr1302	T	C	2: 111,780,659	V113A	probably damaging	Het
Olfr151	T	C	9: 37,730,576	M136V	probably benign	Het
Olfr198	A	G	16: 59,202,133	F98L	probably benign	Het
Olfr293	T	C	7: 86,664,237	S192P	probably damaging	Het
Olfr70	T	A	4: 43,696,961	I71F	probably damaging	Het
Olfr860	G	T	9: 19,845,835	S261R	probably damaging	Het
Olfr877	A	T	9: 37,855,247	Y143F	probably benign	Het
Opn1sw	A	T	6: 29,379,363	I214N	probably damaging	Het
Papss2	T	C	19: 32,639,225	V217A	possibly damaging	Het
Pes1	A	G	11: 3,976,085	I291M	probably benign	Het
Pqlc2	G	A	4: 139,301,870	T101M	probably damaging	Het
Ptprb	T	A	10: 116,362,379	I1660N	possibly damaging	Het
Rapgef1	C	A	2: 29,734,492	T1030K	probably damaging	Het
Rassf8	A	G	6: 145,815,751	M268V	probably benign	Het
Rbl2	A	T	8: 91,076,012	T154S	probably damaging	Het
Rgs1	A	G	1: 144,248,899		probably null	Het
Rpgrip1	C	T	14: 52,121,001	T188I	not run	Het
Rrp1b	T	A	17: 32,058,571	F608L	probably benign	Het
Sbp	C	T	17: 23,945,306	A154V	probably benign	Het
Scara3	C	T	14: 65,931,440	E243K	probably damaging	Het
Serpinb6b	A	T	13: 32,972,257	D110V	probably benign	Het
Skiv2l	T	A	17: 34,841,169	D875V	probably benign	Het
Slc2a4	G	C	11: 69,946,433	T59R	probably damaging	Het
Slc4a1	A	G	11: 102,356,484	S462P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Srf	T	C	17: 46,551,794		probably null	Het
Steap3	A	G	1: 120,227,912	V439A	probably benign	Het
Syt10	C	T	15: 89,814,338	D268N	probably damaging	Het
Terf2	T	C	8: 107,081,217	N242S	probably benign	Het
Tgfbr2	A	T	9: 116,109,738	H365Q	possibly damaging	Het
Tnrc6c	T	G	11: 117,723,528	N837K	probably benign	Het
Trim67	T	A	8: 124,794,330	S144T	probably benign	Het
Zc3hav1l	T	G	6: 38,295,147	D229A	possibly damaging	Het
Zmym4	A	T	4: 126,882,592	V1184E	probably benign	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
R9618:Tex15	UTSW	8	33572369	missense	probably benign	0.35
R9655:Tex15	UTSW	8	33576756	nonsense	probably null
R9786:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R9798:Tex15	UTSW	8	33572693	missense	probably damaging	0.98
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TCAGCCTTCTAACAGTATCAGAAG -3'
(R):5'- AAGCTGTCTGTTGGCTCTAC -3'

Sequencing Primer
(F):5'- CATCTTCATCAAGAACCATATCT -3'
(R):5'- GGCTCTACTTTGCTTTCTGACTTTGG -3'

Posted On

2019-06-26