Incidental Mutation 'R7315:Or8a1'
ID 567889
Institutional Source Beutler Lab
Gene Symbol Or8a1
Ensembl Gene
Gene Name olfactory receptor family 8 subfamily A member 1
Synonyms GA_x6K02T2PVTD-31408136-31407207, Olfr151, M71, MOR171-2
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Not available question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 37641273-37642357 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37641872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 136 (M136V)
Ref Sequence ENSEMBL: ENSMUSP00000148694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000211893] [ENSMUST00000221099]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000211893
AA Change: M136V

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221099
AA Change: M136V

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Or8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6317:Or8a1 UTSW 9 37,641,725 (GRCm39) missense possibly damaging 0.88
R6547:Or8a1 UTSW 9 37,641,791 (GRCm39) missense probably benign 0.00
R6713:Or8a1 UTSW 9 37,641,560 (GRCm39) missense probably damaging 1.00
R7260:Or8a1 UTSW 9 37,642,049 (GRCm39) missense probably damaging 0.98
R7488:Or8a1 UTSW 9 37,641,983 (GRCm39) missense probably damaging 0.98
R7849:Or8a1 UTSW 9 37,642,003 (GRCm39) missense probably damaging 1.00
R7958:Or8a1 UTSW 9 37,641,682 (GRCm39) missense probably damaging 1.00
R8529:Or8a1 UTSW 9 37,642,252 (GRCm39) missense probably damaging 0.99
R9088:Or8a1 UTSW 9 37,641,806 (GRCm39) missense probably damaging 1.00
R9300:Or8a1 UTSW 9 37,641,578 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGCCATTTCTACATCATAGGTAC -3'
(R):5'- ACCTGTCACTCGTGGATCTC -3'

Sequencing Primer
(F):5'- TACTAGAGCAAGAGAGCTTCATG -3'
(R):5'- GTCACTCGTGGATCTCTGCTAC -3'
Posted On 2019-06-26