Incidental Mutation 'R0638:Kcnh7'
ID56789
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0638 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 62777510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 576 (V576L)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052]
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: V576L

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: V576L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Meta Mutation Damage Score 0.2006 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R8183:Kcnh7 UTSW 2 62702977 missense probably damaging 0.99
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCTAGAACTAACCAAGGGATG -3'
(R):5'- TTGAAGACTGCACGACTCCTGC -3'

Sequencing Primer
(F):5'- GGTGTTAGGAGACACATTTCCAAATC -3'
(R):5'- ACGACTCCTGCGTCTTGTG -3'
Posted On2013-07-11