Incidental Mutation 'R7315:Acp3'
ID 567893
Institutional Source Beutler Lab
Gene Symbol Acp3
Ensembl Gene ENSMUSG00000032561
Gene Name acid phosphatase 3
Synonyms A030005E02Rik, Acpp, PAP
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104165439-104214921 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 104193423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062723] [ENSMUST00000112590] [ENSMUST00000215852]
AlphaFold Q8CE08
Predicted Effect probably null
Transcript: ENSMUST00000062723
SMART Domains Protein: ENSMUSP00000059889
Gene: ENSMUSG00000032561

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 3.8e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112590
SMART Domains Protein: ENSMUSP00000108209
Gene: ENSMUSG00000032561

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215852
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thermal nociceptive threshold and mechanical allodynia in chronic inflammatory and nerve injury pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Acp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Acp3 APN 9 104,204,147 (GRCm39) missense probably damaging 1.00
IGL02994:Acp3 APN 9 104,186,602 (GRCm39) splice site probably benign
IGL03069:Acp3 APN 9 104,197,204 (GRCm39) missense possibly damaging 0.78
R0076:Acp3 UTSW 9 104,201,417 (GRCm39) splice site probably benign
R0076:Acp3 UTSW 9 104,201,417 (GRCm39) splice site probably benign
R0084:Acp3 UTSW 9 104,191,564 (GRCm39) missense probably benign 0.07
R0098:Acp3 UTSW 9 104,197,144 (GRCm39) splice site probably null
R0119:Acp3 UTSW 9 104,197,201 (GRCm39) missense probably damaging 1.00
R0299:Acp3 UTSW 9 104,197,201 (GRCm39) missense probably damaging 1.00
R0362:Acp3 UTSW 9 104,191,626 (GRCm39) missense probably damaging 1.00
R0499:Acp3 UTSW 9 104,197,201 (GRCm39) missense probably damaging 1.00
R0514:Acp3 UTSW 9 104,197,177 (GRCm39) missense probably damaging 1.00
R0964:Acp3 UTSW 9 104,204,174 (GRCm39) missense possibly damaging 0.94
R1506:Acp3 UTSW 9 104,201,373 (GRCm39) missense probably damaging 1.00
R1624:Acp3 UTSW 9 104,197,200 (GRCm39) missense probably benign 0.39
R2019:Acp3 UTSW 9 104,201,901 (GRCm39) missense probably damaging 1.00
R3821:Acp3 UTSW 9 104,201,916 (GRCm39) missense probably damaging 0.99
R3822:Acp3 UTSW 9 104,201,916 (GRCm39) missense probably damaging 0.99
R4896:Acp3 UTSW 9 104,184,174 (GRCm39) missense probably damaging 1.00
R5084:Acp3 UTSW 9 104,204,116 (GRCm39) missense probably damaging 1.00
R5257:Acp3 UTSW 9 104,186,674 (GRCm39) missense probably benign 0.24
R5258:Acp3 UTSW 9 104,186,674 (GRCm39) missense probably benign 0.24
R5519:Acp3 UTSW 9 104,168,687 (GRCm39) missense probably damaging 1.00
R5795:Acp3 UTSW 9 104,186,688 (GRCm39) missense probably benign 0.04
R6909:Acp3 UTSW 9 104,178,164 (GRCm39) missense probably damaging 1.00
R7349:Acp3 UTSW 9 104,168,657 (GRCm39) missense probably benign 0.01
R7792:Acp3 UTSW 9 104,204,165 (GRCm39) missense probably damaging 1.00
R8355:Acp3 UTSW 9 104,204,174 (GRCm39) missense possibly damaging 0.94
R8455:Acp3 UTSW 9 104,204,174 (GRCm39) missense possibly damaging 0.94
R9556:Acp3 UTSW 9 104,197,178 (GRCm39) missense probably damaging 1.00
Z1177:Acp3 UTSW 9 104,191,617 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAAGCACATTTGTTTGCCGTTTC -3'
(R):5'- CAGGAACACGTGGCCATAAC -3'

Sequencing Primer
(F):5'- CGTTTCATAAAGGGCAAACGC -3'
(R):5'- GTGGCCATAACCCAAGCTG -3'
Posted On 2019-06-26