Incidental Mutation 'R7315:Kitl'
ID 567895
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Name kit ligand
Synonyms blz, Mgf, SLF, SF, Kitlg, Steel factor, stem cell factor, Steel, Sl, SCF, Gb, grizzle-belly
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 99851492-99936278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99851974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 31 (R31H)
Ref Sequence ENSEMBL: ENSMUSP00000123360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
AlphaFold P20826
Predicted Effect probably benign
Transcript: ENSMUST00000020129
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105283
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130190
AA Change: R31H
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966
AA Change: R31H

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 99,923,206 (GRCm39) splice site probably benign
IGL02066:Kitl APN 10 99,912,744 (GRCm39) missense probably damaging 1.00
IGL03211:Kitl APN 10 99,916,721 (GRCm39) missense probably benign 0.19
Gregory UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
mooyah UTSW 10 99,924,084 (GRCm39) critical splice donor site probably null
Sandycheeks UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R0131:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R0131:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R0132:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R1554:Kitl UTSW 10 99,923,300 (GRCm39) missense probably benign 0.38
R1649:Kitl UTSW 10 99,899,976 (GRCm39) missense probably benign 0.03
R2194:Kitl UTSW 10 99,851,899 (GRCm39) critical splice donor site probably null
R2254:Kitl UTSW 10 99,915,993 (GRCm39) critical splice donor site probably null
R4877:Kitl UTSW 10 99,916,728 (GRCm39) missense probably damaging 1.00
R5135:Kitl UTSW 10 99,924,084 (GRCm39) critical splice donor site probably null
R5453:Kitl UTSW 10 99,923,247 (GRCm39) missense probably damaging 1.00
R5564:Kitl UTSW 10 99,915,886 (GRCm39) missense possibly damaging 0.89
R5832:Kitl UTSW 10 99,915,882 (GRCm39) missense probably damaging 1.00
R5971:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6043:Kitl UTSW 10 99,899,947 (GRCm39) missense probably damaging 1.00
R6067:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6138:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6255:Kitl UTSW 10 99,925,095 (GRCm39) makesense probably null
R6450:Kitl UTSW 10 99,923,256 (GRCm39) start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 99,899,954 (GRCm39) missense probably damaging 1.00
R6951:Kitl UTSW 10 99,887,714 (GRCm39) missense probably damaging 1.00
R7368:Kitl UTSW 10 99,851,943 (GRCm39) missense probably benign 0.02
R8010:Kitl UTSW 10 99,887,765 (GRCm39) missense probably benign 0.22
R8234:Kitl UTSW 10 99,887,708 (GRCm39) missense probably damaging 1.00
R9613:Kitl UTSW 10 99,916,781 (GRCm39) missense probably damaging 1.00
U15987:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGGGACTATCTGCAGC -3'
(R):5'- TTTGCCACTGACAGCTTCAAAC -3'

Sequencing Primer
(F):5'- GACTATCTGCAGCCGCTG -3'
(R):5'- AGCTTCAAACTTCGCAGCTG -3'
Posted On 2019-06-26