Incidental Mutation 'R7315:Ptprb'
ID567896
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7315 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116362379 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1660 (I1660N)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092167
AA Change: I1660N

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: I1660N

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218553
AA Change: I1947N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTTGCCTCAAAGAGATGCTGG -3'
(R):5'- GTCTGAATTGGATGTTGAAAGCAG -3'

Sequencing Primer
(F):5'- GCTGAGTGCAGACTTCCATG -3'
(R):5'- GAAAGAGGGACCTTGTTAG -3'
Posted On2019-06-26