Incidental Mutation 'R7315:Pes1'
ID 567897
Institutional Source Beutler Lab
Gene Symbol Pes1
Ensembl Gene ENSMUSG00000020430
Gene Name pescadillo ribosomal biogenesis factor 1
Synonyms
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 3913975-3930004 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3926085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 291 (I291M)
Ref Sequence ENSEMBL: ENSMUSP00000020705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]
AlphaFold Q9EQ61
Predicted Effect probably benign
Transcript: ENSMUST00000020705
AA Change: I291M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430
AA Change: I291M

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109985
AA Change: I295M

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430
AA Change: I295M

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc2a4 G C 11: 69,837,259 (GRCm39) T59R probably damaging Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Pes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Pes1 APN 11 3,926,803 (GRCm39) missense probably damaging 1.00
IGL01448:Pes1 APN 11 3,927,979 (GRCm39) missense possibly damaging 0.89
H8441:Pes1 UTSW 11 3,927,636 (GRCm39) small deletion probably benign
R0634:Pes1 UTSW 11 3,927,795 (GRCm39) splice site probably benign
R0634:Pes1 UTSW 11 3,927,794 (GRCm39) splice site probably benign
R0883:Pes1 UTSW 11 3,925,557 (GRCm39) missense probably damaging 1.00
R0980:Pes1 UTSW 11 3,927,636 (GRCm39) small deletion probably benign
R1435:Pes1 UTSW 11 3,926,075 (GRCm39) missense probably benign 0.00
R1557:Pes1 UTSW 11 3,926,824 (GRCm39) missense probably damaging 1.00
R1694:Pes1 UTSW 11 3,927,719 (GRCm39) small deletion probably benign
R1885:Pes1 UTSW 11 3,919,482 (GRCm39) missense probably damaging 1.00
R1929:Pes1 UTSW 11 3,919,524 (GRCm39) missense probably damaging 1.00
R2270:Pes1 UTSW 11 3,919,524 (GRCm39) missense probably damaging 1.00
R2272:Pes1 UTSW 11 3,919,524 (GRCm39) missense probably damaging 1.00
R2362:Pes1 UTSW 11 3,927,123 (GRCm39) missense probably damaging 1.00
R2869:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R2869:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R2870:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R2870:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R2871:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R2871:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R2873:Pes1 UTSW 11 3,926,834 (GRCm39) missense probably benign 0.05
R3024:Pes1 UTSW 11 3,927,719 (GRCm39) small deletion probably benign
R3039:Pes1 UTSW 11 3,925,547 (GRCm39) missense probably damaging 1.00
R3195:Pes1 UTSW 11 3,925,736 (GRCm39) splice site probably benign
R3773:Pes1 UTSW 11 3,925,548 (GRCm39) missense probably damaging 1.00
R4590:Pes1 UTSW 11 3,927,986 (GRCm39) missense probably damaging 1.00
R4739:Pes1 UTSW 11 3,914,058 (GRCm39) missense probably damaging 1.00
R5396:Pes1 UTSW 11 3,927,719 (GRCm39) small deletion probably benign
R6016:Pes1 UTSW 11 3,928,004 (GRCm39) missense possibly damaging 0.68
R6351:Pes1 UTSW 11 3,928,865 (GRCm39) missense probably benign
R6921:Pes1 UTSW 11 3,923,330 (GRCm39) missense probably damaging 0.98
R8178:Pes1 UTSW 11 3,927,718 (GRCm39) missense probably benign
R9599:Pes1 UTSW 11 3,926,118 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTTGTTGTAAGACTTACCC -3'
(R):5'- TGTCACCTCCTGCAGAGAAG -3'

Sequencing Primer
(F):5'- GTTGTAAGACTTACCCTTAGAACCC -3'
(R):5'- GAAGGGGCCAAGCTTCACAC -3'
Posted On 2019-06-26