Mutagenetix > Incidental Mutation

Incidental Mutation 'R7315:Lcp2'

567898

Institutional Source

Beutler Lab

Gene Symbol

Lcp2

Ensembl Gene

ENSMUSG00000002699

Gene Name

lymphocyte cytosolic protein 2

Synonyms

twm, SLP76, SLP-76

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7315 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34046920-34092295 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 34069906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000056621 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000109329]

AlphaFold

Q60787

Predicted Effect

probably null
Transcript: ENSMUST00000052413

SMART Domains

Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699

Domain	Start	End	E-Value	Type
SAM	12	78	9.3e-4	SMART
low complexity region	109	127	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
internal_repeat_1	274	321	1.93e-5	PROSPERO
low complexity region	328	339	N/A	INTRINSIC
low complexity region	400	412	N/A	INTRINSIC
SH2	421	512	4.44e-25	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109329

SMART Domains

Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699

Domain	Start	End	E-Value	Type
SAM	12	78	9.3e-4	SMART
low complexity region	109	127	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
internal_repeat_1	274	321	1.86e-5	PROSPERO
low complexity region	328	339	N/A	INTRINSIC
low complexity region	400	412	N/A	INTRINSIC
SH2	421	508	8.9e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	C	7: 120,294,118	I1264L	probably benign	Het
Abcg8	C	A	17: 84,696,714	D484E	probably damaging	Het
Abhd13	T	A	8: 9,987,970	L189H	probably damaging	Het
Acox2	T	C	14: 8,256,139	D60G	probably damaging	Het
Acpp	A	G	9: 104,316,224		probably null	Het
Agpat4	C	T	17: 12,210,298	R146C	probably damaging	Het
Antxrl	T	C	14: 34,071,547	S411P	unknown	Het
B4galt5	A	G	2: 167,301,376	V376A	probably damaging	Het
BB287469	A	G	12: 87,819,703	E128G	unknown	Het
Camk1d	T	C	2: 5,339,230	Y198C	probably damaging	Het
Cd1d1	C	T	3: 86,998,113	R191H	possibly damaging	Het
Cd93	A	G	2: 148,442,541	V295A	probably damaging	Het
Cdc27	G	A	11: 104,515,444	T615I	possibly damaging	Het
Cfap74	T	C	4: 155,463,019	Y1221H	unknown	Het
Col24a1	G	A	3: 145,431,870	S896N	possibly damaging	Het
Cst7	C	A	2: 150,570,583	P22Q	probably benign	Het
Dnah6	C	T	6: 73,084,760	A2781T	probably damaging	Het
Dscaml1	G	A	9: 45,745,125	A1588T	probably benign	Het
Dsg2	A	T	18: 20,579,160	I118F	probably damaging	Het
Eme2	G	A	17: 24,894,866	R62W	probably damaging	Het
Epha3	A	T	16: 63,552,609	D910E	probably benign	Het
Ext1	T	C	15: 53,073,387	D654G	probably damaging	Het
Fam46b	C	T	4: 133,487,084	T422I	probably damaging	Het
Fnip2	A	G	3: 79,506,205		probably null	Het
Gon4l	T	A	3: 88,895,179	H1032Q	probably benign	Het
Ispd	A	G	12: 36,390,374	T94A	probably benign	Het
Kitl	G	A	10: 100,016,112	R31H	unknown	Het
Lrp2	T	C	2: 69,491,822	H1921R	probably damaging	Het
Lvrn	A	G	18: 46,876,984	T400A	probably benign	Het
Mak16	G	A	8: 31,164,738	R143*	probably null	Het
Mettl23	A	G	11: 116,849,102	I159V	probably benign	Het
Mr1	T	C	1: 155,129,290	N335D	probably benign	Het
Muc2	T	C	7: 141,690,402	C12R	probably damaging	Het
Myom1	T	C	17: 71,080,897		probably null	Het
Nav2	A	G	7: 49,548,289	N33S	possibly damaging	Het
Ninl	A	G	2: 150,950,050	V851A	probably benign	Het
Nmt1	A	G	11: 103,060,183	N367D	probably benign	Het
Noc2l	T	G	4: 156,241,360	S354R	probably damaging	Het
Olfr104-ps	G	T	17: 37,362,660	C181F	probably damaging	Het
Olfr1302	T	C	2: 111,780,659	V113A	probably damaging	Het
Olfr151	T	C	9: 37,730,576	M136V	probably benign	Het
Olfr198	A	G	16: 59,202,133	F98L	probably benign	Het
Olfr293	T	C	7: 86,664,237	S192P	probably damaging	Het
Olfr70	T	A	4: 43,696,961	I71F	probably damaging	Het
Olfr860	G	T	9: 19,845,835	S261R	probably damaging	Het
Olfr877	A	T	9: 37,855,247	Y143F	probably benign	Het
Opn1sw	A	T	6: 29,379,363	I214N	probably damaging	Het
Papss2	T	C	19: 32,639,225	V217A	possibly damaging	Het
Pes1	A	G	11: 3,976,085	I291M	probably benign	Het
Pqlc2	G	A	4: 139,301,870	T101M	probably damaging	Het
Ptprb	T	A	10: 116,362,379	I1660N	possibly damaging	Het
Rapgef1	C	A	2: 29,734,492	T1030K	probably damaging	Het
Rassf8	A	G	6: 145,815,751	M268V	probably benign	Het
Rbl2	A	T	8: 91,076,012	T154S	probably damaging	Het
Rgs1	A	G	1: 144,248,899		probably null	Het
Rpgrip1	C	T	14: 52,121,001	T188I	not run	Het
Rrp1b	T	A	17: 32,058,571	F608L	probably benign	Het
Sbp	C	T	17: 23,945,306	A154V	probably benign	Het
Scara3	C	T	14: 65,931,440	E243K	probably damaging	Het
Serpinb6b	A	T	13: 32,972,257	D110V	probably benign	Het
Skiv2l	T	A	17: 34,841,169	D875V	probably benign	Het
Slc2a4	G	C	11: 69,946,433	T59R	probably damaging	Het
Slc4a1	A	G	11: 102,356,484	S462P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Srf	T	C	17: 46,551,794		probably null	Het
Steap3	A	G	1: 120,227,912	V439A	probably benign	Het
Syt10	C	T	15: 89,814,338	D268N	probably damaging	Het
Terf2	T	C	8: 107,081,217	N242S	probably benign	Het
Tex15	A	G	8: 33,581,516	T2364A	probably benign	Het
Tgfbr2	A	T	9: 116,109,738	H365Q	possibly damaging	Het
Tnrc6c	T	G	11: 117,723,528	N837K	probably benign	Het
Trim67	T	A	8: 124,794,330	S144T	probably benign	Het
Zc3hav1l	T	G	6: 38,295,147	D229A	possibly damaging	Het
Zmym4	A	T	4: 126,882,592	V1184E	probably benign	Het

Other mutations in Lcp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01451:Lcp2	APN	11	34047345	start gained	probably benign
IGL01730:Lcp2	APN	11	34050943	missense	possibly damaging	0.91
IGL02174:Lcp2	APN	11	34050966	splice site	probably benign
IGL02228:Lcp2	APN	11	34047424	missense	probably damaging	1.00
IGL02814:Lcp2	APN	11	34071033	missense	probably damaging	1.00
R0142:Lcp2	UTSW	11	34082418	missense	probably damaging	0.97
R0277:Lcp2	UTSW	11	34054322	missense	probably damaging	1.00
R0281:Lcp2	UTSW	11	34069854	splice site	probably benign
R0323:Lcp2	UTSW	11	34054322	missense	probably damaging	1.00
R0437:Lcp2	UTSW	11	34087229	missense	probably benign	0.00
R0632:Lcp2	UTSW	11	34082426	missense	possibly damaging	0.87
R1479:Lcp2	UTSW	11	34075068	missense	probably benign	0.01
R1570:Lcp2	UTSW	11	34089601	missense	probably benign	0.07
R1744:Lcp2	UTSW	11	34069911	splice site	probably null
R2212:Lcp2	UTSW	11	34070995	missense	probably benign	0.14
R2910:Lcp2	UTSW	11	34068970	splice site	probably null
R2911:Lcp2	UTSW	11	34068970	splice site	probably null
R3196:Lcp2	UTSW	11	34090670	missense	probably benign	0.05
R4012:Lcp2	UTSW	11	34068439	missense	probably damaging	1.00
R4411:Lcp2	UTSW	11	34087173	unclassified	probably benign
R4417:Lcp2	UTSW	11	34050917	missense	probably benign	0.27
R4423:Lcp2	UTSW	11	34078226	intron	probably benign
R4718:Lcp2	UTSW	11	34070992	missense	probably benign	0.09
R5090:Lcp2	UTSW	11	34089725	nonsense	probably null
R6347:Lcp2	UTSW	11	34082501	missense	probably benign	0.10
R7694:Lcp2	UTSW	11	34050924	missense	probably benign	0.16
R7910:Lcp2	UTSW	11	34088061	missense	probably damaging	1.00
R8325:Lcp2	UTSW	11	34082394	missense	probably benign	0.34
R8435:Lcp2	UTSW	11	34054316	missense	probably damaging	1.00
R8709:Lcp2	UTSW	11	34054354	critical splice donor site	probably benign
R9091:Lcp2	UTSW	11	34089688	missense
R9270:Lcp2	UTSW	11	34089688	missense
R9566:Lcp2	UTSW	11	34050944	missense

Predicted Primers

PCR Primer
(F):5'- CTTGAAAGACCCAAGTCCAGAG -3'
(R):5'- CCACCTCTGTATTCATCAGGG -3'

Sequencing Primer
(F):5'- CTGGTGGGCTAAATCGTACTCAAC -3'
(R):5'- ATCAGGGAGCTCACTCATTTG -3'

Posted On

2019-06-26