Incidental Mutation 'R7315:Slc2a4'
ID 567899
Institutional Source Beutler Lab
Gene Symbol Slc2a4
Ensembl Gene ENSMUSG00000018566
Gene Name solute carrier family 2 (facilitated glucose transporter), member 4
Synonyms Glut4, Glut-4, twgy
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.634) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69833365-69839014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 69837259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Arginine at position 59 (T59R)
Ref Sequence ENSEMBL: ENSMUSP00000018710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
AlphaFold P14142
Predicted Effect probably benign
Transcript: ENSMUST00000018698
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000018710
AA Change: T59R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566
AA Change: T59R

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141837
AA Change: T59R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566
AA Change: T59R

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152487
Predicted Effect probably benign
Transcript: ENSMUST00000178363
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000179298
AA Change: T59R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566
AA Change: T59R

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired glucose metabolism in skeletal muscle and adipose tissue. Mice homozygous for a knock-out allele show premature death associated with cardiac hypertrophy, growth retardation, insulin resistance, reduced adipose tissue deposits, and muscle fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 119,893,341 (GRCm39) I1264L probably benign Het
Abcg8 C A 17: 85,004,142 (GRCm39) D484E probably damaging Het
Abhd13 T A 8: 10,037,970 (GRCm39) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,193,423 (GRCm39) probably null Het
Agpat4 C T 17: 12,429,185 (GRCm39) R146C probably damaging Het
Antxrl T C 14: 33,793,504 (GRCm39) S411P unknown Het
B4galt5 A G 2: 167,143,296 (GRCm39) V376A probably damaging Het
Camk1d T C 2: 5,344,041 (GRCm39) Y198C probably damaging Het
Cd1d1 C T 3: 86,905,420 (GRCm39) R191H possibly damaging Het
Cd93 A G 2: 148,284,461 (GRCm39) V295A probably damaging Het
Cdc27 G A 11: 104,406,270 (GRCm39) T615I possibly damaging Het
Cfap74 T C 4: 155,547,476 (GRCm39) Y1221H unknown Het
Col24a1 G A 3: 145,137,625 (GRCm39) S896N possibly damaging Het
Crppa A G 12: 36,440,373 (GRCm39) T94A probably benign Het
Cst7 C A 2: 150,412,503 (GRCm39) P22Q probably benign Het
Dnah6 C T 6: 73,061,743 (GRCm39) A2781T probably damaging Het
Dscaml1 G A 9: 45,656,423 (GRCm39) A1588T probably benign Het
Dsg2 A T 18: 20,712,217 (GRCm39) I118F probably damaging Het
Eif1ad2 A G 12: 87,786,473 (GRCm39) E128G unknown Het
Eme2 G A 17: 25,113,840 (GRCm39) R62W probably damaging Het
Epha3 A T 16: 63,372,972 (GRCm39) D910E probably benign Het
Ext1 T C 15: 52,936,783 (GRCm39) D654G probably damaging Het
Fnip2 A G 3: 79,413,512 (GRCm39) probably null Het
Gon4l T A 3: 88,802,486 (GRCm39) H1032Q probably benign Het
Kitl G A 10: 99,851,974 (GRCm39) R31H unknown Het
Lcp2 G A 11: 34,019,906 (GRCm39) probably null Het
Lrp2 T C 2: 69,322,166 (GRCm39) H1921R probably damaging Het
Lvrn A G 18: 47,010,051 (GRCm39) T400A probably benign Het
Mak16 G A 8: 31,654,766 (GRCm39) R143* probably null Het
Mettl23 A G 11: 116,739,928 (GRCm39) I159V probably benign Het
Mr1 T C 1: 155,005,036 (GRCm39) N335D probably benign Het
Muc2 T C 7: 141,276,645 (GRCm39) C12R probably damaging Het
Myom1 T C 17: 71,387,892 (GRCm39) probably null Het
Nav2 A G 7: 49,198,037 (GRCm39) N33S possibly damaging Het
Ninl A G 2: 150,791,970 (GRCm39) V851A probably benign Het
Nmt1 A G 11: 102,951,009 (GRCm39) N367D probably benign Het
Noc2l T G 4: 156,325,817 (GRCm39) S354R probably damaging Het
Opn1sw A T 6: 29,379,362 (GRCm39) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,673,551 (GRCm39) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm39) I71F probably damaging Het
Or14c40 T C 7: 86,313,445 (GRCm39) S192P probably damaging Het
Or4k52 T C 2: 111,611,004 (GRCm39) V113A probably damaging Het
Or5ac16 A G 16: 59,022,496 (GRCm39) F98L probably benign Het
Or7e169 G T 9: 19,757,131 (GRCm39) S261R probably damaging Het
Or8a1 T C 9: 37,641,872 (GRCm39) M136V probably benign Het
Or8b9 A T 9: 37,766,543 (GRCm39) Y143F probably benign Het
Papss2 T C 19: 32,616,625 (GRCm39) V217A possibly damaging Het
Pes1 A G 11: 3,926,085 (GRCm39) I291M probably benign Het
Ptprb T A 10: 116,198,284 (GRCm39) I1660N possibly damaging Het
Rapgef1 C A 2: 29,624,504 (GRCm39) T1030K probably damaging Het
Rassf8 A G 6: 145,761,477 (GRCm39) M268V probably benign Het
Rbl2 A T 8: 91,802,640 (GRCm39) T154S probably damaging Het
Rgs1 A G 1: 144,124,637 (GRCm39) probably null Het
Rpgrip1 C T 14: 52,358,458 (GRCm39) T188I not run Het
Rrp1b T A 17: 32,277,545 (GRCm39) F608L probably benign Het
Sbp C T 17: 24,164,280 (GRCm39) A154V probably benign Het
Scara3 C T 14: 66,168,889 (GRCm39) E243K probably damaging Het
Serpinb6b A T 13: 33,156,240 (GRCm39) D110V probably benign Het
Skic2 T A 17: 35,060,145 (GRCm39) D875V probably benign Het
Slc4a1 A G 11: 102,247,310 (GRCm39) S462P probably damaging Het
Slc66a1 G A 4: 139,029,181 (GRCm39) T101M probably damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Srf T C 17: 46,862,720 (GRCm39) probably null Het
Steap3 A G 1: 120,155,642 (GRCm39) V439A probably benign Het
Syt10 C T 15: 89,698,541 (GRCm39) D268N probably damaging Het
Tent5b C T 4: 133,214,395 (GRCm39) T422I probably damaging Het
Terf2 T C 8: 107,807,849 (GRCm39) N242S probably benign Het
Tex15 A G 8: 34,071,544 (GRCm39) T2364A probably benign Het
Tgfbr2 A T 9: 115,938,806 (GRCm39) H365Q possibly damaging Het
Tnrc6c T G 11: 117,614,354 (GRCm39) N837K probably benign Het
Trim67 T A 8: 125,521,069 (GRCm39) S144T probably benign Het
Zc3hav1l T G 6: 38,272,082 (GRCm39) D229A possibly damaging Het
Zmym4 A T 4: 126,776,385 (GRCm39) V1184E probably benign Het
Other mutations in Slc2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc2a4 APN 11 69,836,782 (GRCm39) splice site probably benign
IGL01448:Slc2a4 APN 11 69,835,902 (GRCm39) missense possibly damaging 0.80
IGL01593:Slc2a4 APN 11 69,835,654 (GRCm39) missense probably damaging 0.98
IGL02188:Slc2a4 APN 11 69,837,156 (GRCm39) start codon destroyed probably null 0.00
IGL02738:Slc2a4 APN 11 69,836,940 (GRCm39) missense probably damaging 1.00
R0282:Slc2a4 UTSW 11 69,837,181 (GRCm39) missense probably damaging 1.00
R0317:Slc2a4 UTSW 11 69,837,182 (GRCm39) missense probably damaging 1.00
R0709:Slc2a4 UTSW 11 69,836,985 (GRCm39) missense possibly damaging 0.92
R1598:Slc2a4 UTSW 11 69,835,844 (GRCm39) missense probably benign 0.00
R1800:Slc2a4 UTSW 11 69,837,133 (GRCm39) missense probably benign 0.08
R1885:Slc2a4 UTSW 11 69,835,833 (GRCm39) missense probably benign 0.03
R1893:Slc2a4 UTSW 11 69,837,398 (GRCm39) missense probably damaging 1.00
R2439:Slc2a4 UTSW 11 69,836,451 (GRCm39) missense possibly damaging 0.93
R2847:Slc2a4 UTSW 11 69,836,997 (GRCm39) missense probably damaging 1.00
R2849:Slc2a4 UTSW 11 69,836,997 (GRCm39) missense probably damaging 1.00
R2865:Slc2a4 UTSW 11 69,836,942 (GRCm39) missense probably damaging 1.00
R3001:Slc2a4 UTSW 11 69,836,751 (GRCm39) nonsense probably null
R3002:Slc2a4 UTSW 11 69,836,751 (GRCm39) nonsense probably null
R4455:Slc2a4 UTSW 11 69,834,148 (GRCm39) unclassified probably benign
R4456:Slc2a4 UTSW 11 69,834,148 (GRCm39) unclassified probably benign
R4463:Slc2a4 UTSW 11 69,834,148 (GRCm39) unclassified probably benign
R4622:Slc2a4 UTSW 11 69,835,600 (GRCm39) unclassified probably benign
R4822:Slc2a4 UTSW 11 69,837,413 (GRCm39) missense probably damaging 1.00
R5695:Slc2a4 UTSW 11 69,837,217 (GRCm39) missense probably damaging 1.00
R6348:Slc2a4 UTSW 11 69,835,848 (GRCm39) missense probably benign 0.03
R7294:Slc2a4 UTSW 11 69,836,225 (GRCm39) missense probably benign 0.00
R7492:Slc2a4 UTSW 11 69,837,202 (GRCm39) missense probably benign 0.42
R8060:Slc2a4 UTSW 11 69,835,836 (GRCm39) missense possibly damaging 0.68
R9103:Slc2a4 UTSW 11 69,836,218 (GRCm39) missense probably benign 0.24
R9416:Slc2a4 UTSW 11 69,836,728 (GRCm39) missense probably benign 0.04
R9565:Slc2a4 UTSW 11 69,837,173 (GRCm39) missense probably damaging 1.00
R9582:Slc2a4 UTSW 11 69,837,450 (GRCm39) missense probably damaging 0.98
X0067:Slc2a4 UTSW 11 69,835,082 (GRCm39) missense probably benign 0.11
Z1186:Slc2a4 UTSW 11 69,834,819 (GRCm39) frame shift probably null
Z1186:Slc2a4 UTSW 11 69,834,818 (GRCm39) unclassified probably benign
Z1186:Slc2a4 UTSW 11 69,834,817 (GRCm39) frame shift probably null
Z1187:Slc2a4 UTSW 11 69,834,819 (GRCm39) frame shift probably null
Z1187:Slc2a4 UTSW 11 69,834,818 (GRCm39) unclassified probably benign
Z1188:Slc2a4 UTSW 11 69,834,819 (GRCm39) frame shift probably null
Z1188:Slc2a4 UTSW 11 69,834,818 (GRCm39) unclassified probably benign
Z1189:Slc2a4 UTSW 11 69,834,819 (GRCm39) frame shift probably null
Z1189:Slc2a4 UTSW 11 69,834,818 (GRCm39) unclassified probably benign
Z1190:Slc2a4 UTSW 11 69,834,819 (GRCm39) frame shift probably null
Z1191:Slc2a4 UTSW 11 69,834,819 (GRCm39) frame shift probably null
Z1191:Slc2a4 UTSW 11 69,834,818 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTTCCTGGCAGGCACACAG -3'
(R):5'- CCTTCAGTTTGGCTATAACATTGGG -3'

Sequencing Primer
(F):5'- TCACGACACCCATGCTGTG -3'
(R):5'- TGGGGTTATCAATGCCCCACAG -3'
Posted On 2019-06-26