Incidental Mutation 'R7315:Nmt1'
ID 567901
Institutional Source Beutler Lab
Gene Symbol Nmt1
Ensembl Gene ENSMUSG00000020936
Gene Name N-myristoyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103028190-103068912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103060183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 367 (N367D)
Ref Sequence ENSEMBL: ENSMUSP00000021314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314]
AlphaFold O70310
Predicted Effect probably benign
Transcript: ENSMUST00000021314
AA Change: N367D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: N367D

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acox2 T C 14: 8,256,139 D60G probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Nmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Nmt1 APN 11 103060076 critical splice acceptor site probably null
IGL02058:Nmt1 APN 11 103052290 missense probably benign 0.00
IGL02582:Nmt1 APN 11 103064799 missense possibly damaging 0.94
cropped UTSW 11 103056459 missense probably damaging 1.00
R0092:Nmt1 UTSW 11 103046493 missense probably damaging 1.00
R1401:Nmt1 UTSW 11 103057481 missense probably damaging 0.99
R1827:Nmt1 UTSW 11 103064838 missense probably damaging 1.00
R1878:Nmt1 UTSW 11 103052251 missense probably benign
R2199:Nmt1 UTSW 11 103063856 missense probably damaging 1.00
R3930:Nmt1 UTSW 11 103052233 missense probably benign 0.37
R4373:Nmt1 UTSW 11 103043200 missense probably damaging 0.99
R4648:Nmt1 UTSW 11 103063917 missense probably damaging 1.00
R5666:Nmt1 UTSW 11 103058215 nonsense probably null
R6908:Nmt1 UTSW 11 103058254 missense possibly damaging 0.92
R7473:Nmt1 UTSW 11 103046400 missense probably benign 0.05
R7504:Nmt1 UTSW 11 103056459 missense probably damaging 1.00
R8548:Nmt1 UTSW 11 103043226 missense possibly damaging 0.80
R8913:Nmt1 UTSW 11 103057445 missense probably damaging 1.00
X0018:Nmt1 UTSW 11 103028586 missense probably benign 0.01
Z1177:Nmt1 UTSW 11 103055213 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGATGCCTAGAGGACTATAGC -3'
(R):5'- AACTAAGGGGTACGGTGCTC -3'

Sequencing Primer
(F):5'- CCTAGAGGACTATAGCTGATGCTG -3'
(R):5'- CTCTATTTTCTACTGAGATGACCACG -3'
Posted On 2019-06-26