Incidental Mutation 'R7315:Serpinb6b'
ID 567907
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission 045368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32972257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 110 (D110V)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect possibly damaging
Transcript: ENSMUST00000017184
AA Change: D110V

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842
AA Change: D110V

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110293
AA Change: D110V

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: D110V

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 (GRCm38) I1264L probably benign Het
Abcg8 C A 17: 84,696,714 (GRCm38) D484E probably damaging Het
Abhd13 T A 8: 9,987,970 (GRCm38) L189H probably damaging Het
Acox2 T C 14: 8,256,139 (GRCm38) D60G probably damaging Het
Acp3 A G 9: 104,316,224 (GRCm38) probably null Het
Agpat4 C T 17: 12,210,298 (GRCm38) R146C probably damaging Het
Antxrl T C 14: 34,071,547 (GRCm38) S411P unknown Het
B4galt5 A G 2: 167,301,376 (GRCm38) V376A probably damaging Het
Camk1d T C 2: 5,339,230 (GRCm38) Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 (GRCm38) R191H possibly damaging Het
Cd93 A G 2: 148,442,541 (GRCm38) V295A probably damaging Het
Cdc27 G A 11: 104,515,444 (GRCm38) T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 (GRCm38) Y1221H unknown Het
Col24a1 G A 3: 145,431,870 (GRCm38) S896N possibly damaging Het
Crppa A G 12: 36,390,374 (GRCm38) T94A probably benign Het
Cst7 C A 2: 150,570,583 (GRCm38) P22Q probably benign Het
Dnah6 C T 6: 73,084,760 (GRCm38) A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 (GRCm38) A1588T probably benign Het
Dsg2 A T 18: 20,579,160 (GRCm38) I118F probably damaging Het
Eif1ad2 A G 12: 87,819,703 (GRCm38) E128G unknown Het
Eme2 G A 17: 24,894,866 (GRCm38) R62W probably damaging Het
Epha3 A T 16: 63,552,609 (GRCm38) D910E probably benign Het
Ext1 T C 15: 53,073,387 (GRCm38) D654G probably damaging Het
Fnip2 A G 3: 79,506,205 (GRCm38) probably null Het
Gon4l T A 3: 88,895,179 (GRCm38) H1032Q probably benign Het
Kitl G A 10: 100,016,112 (GRCm38) R31H unknown Het
Lcp2 G A 11: 34,069,906 (GRCm38) probably null Het
Lrp2 T C 2: 69,491,822 (GRCm38) H1921R probably damaging Het
Lvrn A G 18: 46,876,984 (GRCm38) T400A probably benign Het
Mak16 G A 8: 31,164,738 (GRCm38) R143* probably null Het
Mettl23 A G 11: 116,849,102 (GRCm38) I159V probably benign Het
Mr1 T C 1: 155,129,290 (GRCm38) N335D probably benign Het
Muc2 T C 7: 141,690,402 (GRCm38) C12R probably damaging Het
Myom1 T C 17: 71,080,897 (GRCm38) probably null Het
Nav2 A G 7: 49,548,289 (GRCm38) N33S possibly damaging Het
Ninl A G 2: 150,950,050 (GRCm38) V851A probably benign Het
Nmt1 A G 11: 103,060,183 (GRCm38) N367D probably benign Het
Noc2l T G 4: 156,241,360 (GRCm38) S354R probably damaging Het
Opn1sw A T 6: 29,379,363 (GRCm38) I214N probably damaging Het
Or12d14-ps1 G T 17: 37,362,660 (GRCm38) C181F probably damaging Het
Or13e8 T A 4: 43,696,961 (GRCm38) I71F probably damaging Het
Or14c40 T C 7: 86,664,237 (GRCm38) S192P probably damaging Het
Or4k52 T C 2: 111,780,659 (GRCm38) V113A probably damaging Het
Or5ac16 A G 16: 59,202,133 (GRCm38) F98L probably benign Het
Or7e169 G T 9: 19,845,835 (GRCm38) S261R probably damaging Het
Or8a1 T C 9: 37,730,576 (GRCm38) M136V probably benign Het
Or8b9 A T 9: 37,855,247 (GRCm38) Y143F probably benign Het
Papss2 T C 19: 32,639,225 (GRCm38) V217A possibly damaging Het
Pes1 A G 11: 3,976,085 (GRCm38) I291M probably benign Het
Ptprb T A 10: 116,362,379 (GRCm38) I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 (GRCm38) T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 (GRCm38) M268V probably benign Het
Rbl2 A T 8: 91,076,012 (GRCm38) T154S probably damaging Het
Rgs1 A G 1: 144,248,899 (GRCm38) probably null Het
Rpgrip1 C T 14: 52,121,001 (GRCm38) T188I not run Het
Rrp1b T A 17: 32,058,571 (GRCm38) F608L probably benign Het
Sbp C T 17: 23,945,306 (GRCm38) A154V probably benign Het
Scara3 C T 14: 65,931,440 (GRCm38) E243K probably damaging Het
Skic2 T A 17: 34,841,169 (GRCm38) D875V probably benign Het
Slc2a4 G C 11: 69,946,433 (GRCm38) T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 (GRCm38) S462P probably damaging Het
Slc66a1 G A 4: 139,301,870 (GRCm38) T101M probably damaging Het
Snx33 C T 9: 56,925,867 (GRCm38) R306H probably damaging Het
Srf T C 17: 46,551,794 (GRCm38) probably null Het
Steap3 A G 1: 120,227,912 (GRCm38) V439A probably benign Het
Syt10 C T 15: 89,814,338 (GRCm38) D268N probably damaging Het
Tent5b C T 4: 133,487,084 (GRCm38) T422I probably damaging Het
Terf2 T C 8: 107,081,217 (GRCm38) N242S probably benign Het
Tex15 A G 8: 33,581,516 (GRCm38) T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 (GRCm38) H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 (GRCm38) N837K probably benign Het
Trim67 T A 8: 124,794,330 (GRCm38) S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 (GRCm38) D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 (GRCm38) V1184E probably benign Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32,971,546 (GRCm38) missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32,978,066 (GRCm38) missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32,974,948 (GRCm38) missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32,971,606 (GRCm38) missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32,978,237 (GRCm38) missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32,974,912 (GRCm38) missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32,974,995 (GRCm38) missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32,978,058 (GRCm38) missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32,978,240 (GRCm38) missense probably benign
R1918:Serpinb6b UTSW 13 32,978,240 (GRCm38) missense probably benign
R1919:Serpinb6b UTSW 13 32,978,240 (GRCm38) missense probably benign
R1920:Serpinb6b UTSW 13 32,975,008 (GRCm38) missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32,968,568 (GRCm38) missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32,972,263 (GRCm38) missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32,978,150 (GRCm38) missense probably benign
R5503:Serpinb6b UTSW 13 32,977,659 (GRCm38) missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32,977,558 (GRCm38) nonsense probably null
R6061:Serpinb6b UTSW 13 32,977,994 (GRCm38) missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32,972,272 (GRCm38) missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32,971,615 (GRCm38) missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32,977,576 (GRCm38) missense probably benign 0.23
R7424:Serpinb6b UTSW 13 32,968,667 (GRCm38) missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32,974,924 (GRCm38) missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32,968,607 (GRCm38) missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32,977,529 (GRCm38) missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32,971,596 (GRCm38)
R8814:Serpinb6b UTSW 13 32,978,304 (GRCm38) missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32,978,052 (GRCm38) missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32,978,142 (GRCm38) missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32,978,015 (GRCm38) nonsense probably null
R9129:Serpinb6b UTSW 13 32,978,156 (GRCm38) small deletion probably benign
R9377:Serpinb6b UTSW 13 32,968,511 (GRCm38) start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32,975,019 (GRCm38) missense
R9632:Serpinb6b UTSW 13 32,971,549 (GRCm38) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTAAGATGGTTGTCTTACCCAACTC -3'
(R):5'- AGCATGTTCAAGGCCATGGG -3'

Sequencing Primer
(F):5'- GGTTGTCTTACCCAACTCAATAAC -3'
(R):5'- TTCAAGGCCATGGGTCCCAG -3'
Posted On 2019-06-26