Incidental Mutation 'R7315:Acox2'
ID567908
Institutional Source Beutler Lab
Gene Symbol Acox2
Ensembl Gene ENSMUSG00000021751
Gene Nameacyl-Coenzyme A oxidase 2, branched chain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7315 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location8225511-8259353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8256139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 60 (D60G)
Ref Sequence ENSEMBL: ENSMUSP00000022271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598] [ENSMUST00000170534]
Predicted Effect probably damaging
Transcript: ENSMUST00000022271
AA Change: D60G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: D60G

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164598
AA Change: D60G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: D60G

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170534
AA Change: D60G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130543
Gene: ENSMUSG00000021751
AA Change: D60G

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 4.1e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A C 7: 120,294,118 I1264L probably benign Het
Abcg8 C A 17: 84,696,714 D484E probably damaging Het
Abhd13 T A 8: 9,987,970 L189H probably damaging Het
Acpp A G 9: 104,316,224 probably null Het
Agpat4 C T 17: 12,210,298 R146C probably damaging Het
Antxrl T C 14: 34,071,547 S411P unknown Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
BB287469 A G 12: 87,819,703 E128G unknown Het
Camk1d T C 2: 5,339,230 Y198C probably damaging Het
Cd1d1 C T 3: 86,998,113 R191H possibly damaging Het
Cd93 A G 2: 148,442,541 V295A probably damaging Het
Cdc27 G A 11: 104,515,444 T615I possibly damaging Het
Cfap74 T C 4: 155,463,019 Y1221H unknown Het
Col24a1 G A 3: 145,431,870 S896N possibly damaging Het
Cst7 C A 2: 150,570,583 P22Q probably benign Het
Dnah6 C T 6: 73,084,760 A2781T probably damaging Het
Dscaml1 G A 9: 45,745,125 A1588T probably benign Het
Dsg2 A T 18: 20,579,160 I118F probably damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Epha3 A T 16: 63,552,609 D910E probably benign Het
Ext1 T C 15: 53,073,387 D654G probably damaging Het
Fam46b C T 4: 133,487,084 T422I probably damaging Het
Fnip2 A G 3: 79,506,205 probably null Het
Gon4l T A 3: 88,895,179 H1032Q probably benign Het
Ispd A G 12: 36,390,374 T94A probably benign Het
Kitl G A 10: 100,016,112 R31H unknown Het
Lcp2 G A 11: 34,069,906 probably null Het
Lrp2 T C 2: 69,491,822 H1921R probably damaging Het
Lvrn A G 18: 46,876,984 T400A probably benign Het
Mak16 G A 8: 31,164,738 R143* probably null Het
Mettl23 A G 11: 116,849,102 I159V probably benign Het
Mr1 T C 1: 155,129,290 N335D probably benign Het
Muc2 T C 7: 141,690,402 C12R probably damaging Het
Myom1 T C 17: 71,080,897 probably null Het
Nav2 A G 7: 49,548,289 N33S possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Nmt1 A G 11: 103,060,183 N367D probably benign Het
Noc2l T G 4: 156,241,360 S354R probably damaging Het
Olfr104-ps G T 17: 37,362,660 C181F probably damaging Het
Olfr1302 T C 2: 111,780,659 V113A probably damaging Het
Olfr151 T C 9: 37,730,576 M136V probably benign Het
Olfr198 A G 16: 59,202,133 F98L probably benign Het
Olfr293 T C 7: 86,664,237 S192P probably damaging Het
Olfr70 T A 4: 43,696,961 I71F probably damaging Het
Olfr860 G T 9: 19,845,835 S261R probably damaging Het
Olfr877 A T 9: 37,855,247 Y143F probably benign Het
Opn1sw A T 6: 29,379,363 I214N probably damaging Het
Papss2 T C 19: 32,639,225 V217A possibly damaging Het
Pes1 A G 11: 3,976,085 I291M probably benign Het
Pqlc2 G A 4: 139,301,870 T101M probably damaging Het
Ptprb T A 10: 116,362,379 I1660N possibly damaging Het
Rapgef1 C A 2: 29,734,492 T1030K probably damaging Het
Rassf8 A G 6: 145,815,751 M268V probably benign Het
Rbl2 A T 8: 91,076,012 T154S probably damaging Het
Rgs1 A G 1: 144,248,899 probably null Het
Rpgrip1 C T 14: 52,121,001 T188I not run Het
Rrp1b T A 17: 32,058,571 F608L probably benign Het
Sbp C T 17: 23,945,306 A154V probably benign Het
Scara3 C T 14: 65,931,440 E243K probably damaging Het
Serpinb6b A T 13: 32,972,257 D110V probably benign Het
Skiv2l T A 17: 34,841,169 D875V probably benign Het
Slc2a4 G C 11: 69,946,433 T59R probably damaging Het
Slc4a1 A G 11: 102,356,484 S462P probably damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Srf T C 17: 46,551,794 probably null Het
Steap3 A G 1: 120,227,912 V439A probably benign Het
Syt10 C T 15: 89,814,338 D268N probably damaging Het
Terf2 T C 8: 107,081,217 N242S probably benign Het
Tex15 A G 8: 33,581,516 T2364A probably benign Het
Tgfbr2 A T 9: 116,109,738 H365Q possibly damaging Het
Tnrc6c T G 11: 117,723,528 N837K probably benign Het
Trim67 T A 8: 124,794,330 S144T probably benign Het
Zc3hav1l T G 6: 38,295,147 D229A possibly damaging Het
Zmym4 A T 4: 126,882,592 V1184E probably benign Het
Other mutations in Acox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Acox2 APN 14 8246363 missense probably damaging 1.00
IGL01845:Acox2 APN 14 8251617 missense probably damaging 1.00
IGL02830:Acox2 APN 14 8255298 missense probably damaging 1.00
R0415:Acox2 UTSW 14 8243835 splice site probably benign
R0535:Acox2 UTSW 14 8256753 missense probably damaging 1.00
R1424:Acox2 UTSW 14 8230247 missense probably benign 0.02
R1836:Acox2 UTSW 14 8248059 missense possibly damaging 0.91
R1862:Acox2 UTSW 14 8241416 missense probably benign 0.07
R1885:Acox2 UTSW 14 8248102 missense probably benign 0.00
R2032:Acox2 UTSW 14 8246400 missense probably benign 0.00
R2268:Acox2 UTSW 14 8253496 missense probably damaging 0.98
R2497:Acox2 UTSW 14 8251612 missense probably benign 0.00
R3032:Acox2 UTSW 14 8253466 missense probably damaging 1.00
R3842:Acox2 UTSW 14 8251543 missense probably damaging 1.00
R3874:Acox2 UTSW 14 8248061 missense probably benign 0.00
R4763:Acox2 UTSW 14 8241334 missense possibly damaging 0.81
R5072:Acox2 UTSW 14 8241374 nonsense probably null
R5397:Acox2 UTSW 14 8243803 missense probably benign 0.02
R5950:Acox2 UTSW 14 8255793 missense probably benign
R7188:Acox2 UTSW 14 8252996 missense possibly damaging 0.67
R7208:Acox2 UTSW 14 8241303 missense probably benign 0.27
R7757:Acox2 UTSW 14 8230166 missense probably damaging 1.00
R7888:Acox2 UTSW 14 8246415 missense probably benign 0.00
R8269:Acox2 UTSW 14 8246325 missense probably benign 0.00
Z1177:Acox2 UTSW 14 8256852 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCATGGGTTGCAGGCAAG -3'
(R):5'- CACACACCTGTCACGCTCTG -3'

Sequencing Primer
(F):5'- CAGGCAAGCCTTTCTGATGAG -3'
(R):5'- GGAGTGGACAAAGCACATTTCTCTC -3'
Posted On2019-06-26